Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Abca17'

224462

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1997 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24285726 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1233 (I1233T)

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

AlphaFold

E9PX95

Predicted Effect

probably benign
Transcript: ENSMUST00000039324
AA Change: I1233T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: I1233T

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121226
AA Change: I1233T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: I1233T

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Loxhd1	G	T	18: 77,295,769	W121C	probably damaging	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
basin	UTSW	17	24318185	missense	probably benign	0.01
Bowl	UTSW	17	24317238	missense	probably benign	0.09
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3695:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R7915:Abca17	UTSW	17	24265533	missense	probably damaging	1.00
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
R8095:Abca17	UTSW	17	24317222	missense	possibly damaging	0.77
R8308:Abca17	UTSW	17	24267683	missense	probably damaging	1.00
R8517:Abca17	UTSW	17	24317233	missense	probably benign	0.00
R8811:Abca17	UTSW	17	24317238	missense	probably benign	0.09
R8819:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8820:Abca17	UTSW	17	24328602	missense	probably damaging	1.00
R8953:Abca17	UTSW	17	24299041	missense	probably benign
R9095:Abca17	UTSW	17	24281396	missense	probably damaging	0.97
R9313:Abca17	UTSW	17	24346233	missense	probably benign	0.00
R9314:Abca17	UTSW	17	24328619	missense	possibly damaging	0.91
R9347:Abca17	UTSW	17	24264505	missense	probably benign
R9351:Abca17	UTSW	17	24291777	missense	probably benign	0.00
R9387:Abca17	UTSW	17	24334281	missense	probably benign	0.02
R9388:Abca17	UTSW	17	24264299	missense	unknown
R9440:Abca17	UTSW	17	24280478	missense	probably benign	0.02
R9498:Abca17	UTSW	17	24265506	missense	probably damaging	1.00
R9654:Abca17	UTSW	17	24317125	missense	probably benign	0.09
R9709:Abca17	UTSW	17	24298960	missense	probably benign
R9770:Abca17	UTSW	17	24295147	missense	probably benign	0.00
R9773:Abca17	UTSW	17	24289591	missense	probably damaging	1.00
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCCAAATCGTATTACACAAACC -3'
(R):5'- TGGATAAAGGAAGTGGCAGATCT -3'

Sequencing Primer
(F):5'- CAAGTTCTTAGCACTGCAA -3'
(R):5'- GTCAACACCAGGAGTCAGG -3'

Posted On

2014-08-25