Mutagenetix > Incidental Mutation

Incidental Mutation 'R1997:Loxhd1'

224472

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

040007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.247) question?

Stock #

R1997 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 77295769 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Cysteine at position 121 (W121C)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547]

AlphaFold

C8YR32

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: W121C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: W121C

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	T	6: 48,932,429	Q536L	probably damaging	Het
3425401B19Rik	A	G	14: 32,660,048	F1320S	possibly damaging	Het
Aaas	C	T	15: 102,340,059	V241I	probably benign	Het
Abca17	A	G	17: 24,285,726	I1233T	probably benign	Het
Acin1	T	C	14: 54,646,699		probably null	Het
Acly	A	T	11: 100,519,151	I185N	probably damaging	Het
Adamts16	T	C	13: 70,753,267	D897G	probably benign	Het
Allc	A	C	12: 28,563,483	D153E	probably benign	Het
Ankrd12	A	G	17: 65,984,884	S1185P	probably damaging	Het
Ap1g2	T	C	14: 55,102,378	E448G	probably benign	Het
Atg9a	A	T	1: 75,189,626	V50D	probably benign	Het
Bace2	A	T	16: 97,415,089	D294V	possibly damaging	Het
Camsap2	T	C	1: 136,271,545	K708E	probably damaging	Het
Card10	G	A	15: 78,793,975	R358C	probably damaging	Het
Ccdc81	A	T	7: 89,898,063	V39E	probably damaging	Het
Cdh7	A	T	1: 110,048,938	D111V	probably damaging	Het
Cercam	C	A	2: 29,872,923	T223K	probably benign	Het
Cog5	A	G	12: 31,660,849	H76R	possibly damaging	Het
Col28a1	A	T	6: 7,999,644	N1024K	probably benign	Het
Csrnp3	A	T	2: 65,949,102	N41Y	probably damaging	Het
Cyp2t4	G	A	7: 27,157,613		probably null	Het
Dbn1	T	C	13: 55,482,441	H38R	probably damaging	Het
Dclre1b	A	G	3: 103,803,356	V287A	probably benign	Het
Dennd4c	A	G	4: 86,837,397	T1609A	probably benign	Het
Depdc5	T	A	5: 32,901,906		probably null	Het
Dhcr7	T	G	7: 143,847,430	D446E	probably damaging	Het
Dlx5	A	T	6: 6,879,680	M129K	possibly damaging	Het
Dnah11	C	G	12: 118,082,468	G1745A	possibly damaging	Het
Dnm3	T	C	1: 162,353,712	T133A	possibly damaging	Het
Eif3e	A	G	15: 43,265,609	L205P	probably damaging	Het
Fam166a	T	G	2: 25,220,205	L43R	probably damaging	Het
Fam91a1	A	G	15: 58,424,195		probably null	Het
Fank1	C	T	7: 133,862,225	T50I	probably damaging	Het
Fhod3	A	G	18: 25,090,416	T940A	possibly damaging	Het
Fkbp10	T	C	11: 100,416,015	F78L	probably damaging	Het
Gabbr2	A	C	4: 46,787,502	F387C	probably damaging	Het
Ggnbp2	A	T	11: 84,860,561	L138I	probably damaging	Het
Gm2832	T	A	14: 41,280,986		probably null	Het
Gm38394	A	G	1: 133,656,713	L962P	probably damaging	Het
Gm5084	T	A	13: 60,212,530		noncoding transcript	Het
Gm9979	T	C	13: 40,705,752		noncoding transcript	Het
Hepacam2	A	G	6: 3,487,241	S39P	probably damaging	Het
Hesx1	A	T	14: 27,001,383	N57Y	probably damaging	Het
Kcnh1	G	A	1: 192,276,935	V266I	probably damaging	Het
Kif24	T	C	4: 41,392,904	T1168A	possibly damaging	Het
Kng2	A	T	16: 23,024,876	F118I	possibly damaging	Het
Lig3	C	T	11: 82,787,666	P245S	probably benign	Het
Ltn1	A	G	16: 87,381,637	V1568A	probably damaging	Het
Map3k4	A	T	17: 12,254,995		probably null	Het
Mcm10	C	T	2: 4,993,760	V790M	probably damaging	Het
Mia3	A	T	1: 183,344,286	F1223I	possibly damaging	Het
Mlec	C	A	5: 115,150,346	K150N	probably damaging	Het
Morn4	T	C	19: 42,076,538	K70R	possibly damaging	Het
Mphosph10	A	C	7: 64,387,447		probably null	Het
Myocd	G	A	11: 65,204,321	Q47*	probably null	Het
Nav2	T	A	7: 49,548,471	S1283T	probably benign	Het
Nbeal2	T	C	9: 110,632,198	H1599R	probably damaging	Het
Nek10	G	T	14: 14,827,003	G67V	probably benign	Het
Nlgn2	A	C	11: 69,828,050	V271G	probably damaging	Het
Olfr167	A	C	16: 19,515,042	V198G	probably damaging	Het
Olfr97	A	G	17: 37,231,632	V246A	probably damaging	Het
Pcolce2	A	T	9: 95,694,740	M355L	probably benign	Het
Per2	T	C	1: 91,440,859	E264G	probably damaging	Het
Phf2	A	G	13: 48,828,908	L113P	unknown	Het
Piwil2	A	G	14: 70,426,658	V14A	possibly damaging	Het
Plekha6	G	A	1: 133,263,818	A146T	probably benign	Het
Plxnb2	C	T	15: 89,158,768	V1473I	probably benign	Het
Pms2	T	C	5: 143,913,700	L111P	probably damaging	Het
Polg	A	G	7: 79,459,231	L533P	probably damaging	Het
Ppp1r12b	A	G	1: 134,846,355		probably benign	Het
Ppp2r1b	T	A	9: 50,867,371	M208K	possibly damaging	Het
Prdm5	A	G	6: 65,936,088	Y207C	probably damaging	Het
Prkar2b	A	G	12: 31,963,935	V314A	probably damaging	Het
Proser1	T	A	3: 53,478,871	S725T	probably benign	Het
Psg20	A	G	7: 18,682,610	F194L	probably benign	Het
Ptprz1	A	G	6: 23,050,497	I2255V	probably damaging	Het
Sardh	T	G	2: 27,244,397	T36P	probably damaging	Het
Sec23a	T	A	12: 59,002,007	I110L	probably benign	Het
Slc22a29	T	A	19: 8,217,798	I158L	probably benign	Het
Slc35c1	T	C	2: 92,454,639	D210G	probably benign	Het
Syde2	A	G	3: 145,998,991	N566S	probably benign	Het
Tcf20	G	A	15: 82,857,230	Q7*	probably null	Het
Terb2	T	A	2: 122,204,857	H186Q	possibly damaging	Het
Tet2	G	A	3: 133,486,589	Q695*	probably null	Het
Tnfaip1	T	C	11: 78,530,147	Y29C	probably damaging	Het
Traf3	A	G	12: 111,260,661	K328E	probably benign	Het
Uaca	A	G	9: 60,870,341	E668G	probably damaging	Het
Ube2o	T	A	11: 116,545,337	E326V	probably damaging	Het
Ubr1	C	T	2: 120,946,273		probably null	Het
Vmn1r19	T	A	6: 57,405,048	S195R	probably damaging	Het
Vmn1r213	T	G	13: 23,012,303	V352G	probably benign	Het
Vmn2r19	T	A	6: 123,315,921	D307E	probably damaging	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Zan	A	T	5: 137,403,114	C4114*	probably null	Het
Zdhhc23	A	T	16: 43,978,942	C37S	probably damaging	Het
Zfp628	G	T	7: 4,918,832	G18W	probably damaging	Het
Zfp712	T	A	13: 67,042,050	K138*	probably null	Het
Zfp867	A	T	11: 59,463,591	V304D	probably damaging	Het
Zfp870	T	C	17: 32,884,053	T102A	possibly damaging	Het
Zmym5	G	A	14: 56,797,753	S286L	possibly damaging	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
R9619:Loxhd1	UTSW	18	77356175	missense	probably benign	0.32
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCATGAATAGATGAGGAAAC -3'
(R):5'- AAGGTAGGGTTCCAGAGCAC -3'

Sequencing Primer
(F):5'- ATGAGGAAACTTAGAACCAAAGTAAG -3'
(R):5'- TTCCAGAGCACAGCAAGG -3'

Posted On

2014-08-25