Incidental Mutation 'R2035:Clcn3'
ID224483
Institutional Source Beutler Lab
Gene Symbol Clcn3
Ensembl Gene ENSMUSG00000004319
Gene Namechloride channel, voltage-sensitive 3
SynonymsClc3
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60910389-60983300 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60934598 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 179 (S179T)
Ref Sequence ENSEMBL: ENSMUSP00000105931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]
Predicted Effect probably damaging
Transcript: ENSMUST00000004430
AA Change: S206T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: S206T

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 1.4e-111 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 2.08e-8 SMART
low complexity region 847 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056508
AA Change: S179T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: S179T

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.4e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093490
AA Change: S148T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: S148T

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
Pfam:Voltage_CLC 162 565 1.2e-103 PFAM
CBS 609 659 2.46e-1 SMART
CBS 700 747 6.59e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110301
AA Change: S206T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: S206T

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
Pfam:Voltage_CLC 220 623 2.7e-103 PFAM
CBS 667 717 2.46e-1 SMART
CBS 758 805 6.59e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110302
AA Change: S179T

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: S179T

DomainStartEndE-ValueType
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Voltage_CLC 193 596 1.3e-103 PFAM
CBS 640 690 2.46e-1 SMART
CBS 731 778 2.08e-8 SMART
low complexity region 820 834 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147824
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Clcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Clcn3 APN 8 60922792 missense probably damaging 0.99
IGL01088:Clcn3 APN 8 60937347 missense probably damaging 1.00
IGL01449:Clcn3 APN 8 60934598 missense probably damaging 0.97
IGL01792:Clcn3 APN 8 60929322 missense probably damaging 1.00
IGL01845:Clcn3 APN 8 60913095 missense probably benign 0.08
IGL01984:Clcn3 APN 8 60929580 missense probably damaging 1.00
IGL02041:Clcn3 APN 8 60923153 missense probably damaging 0.99
IGL02199:Clcn3 APN 8 60933092 nonsense probably null
IGL02199:Clcn3 APN 8 60927274 missense possibly damaging 0.82
IGL02456:Clcn3 APN 8 60941357 missense probably damaging 1.00
IGL03353:Clcn3 APN 8 60922988 missense probably benign 0.37
R0003:Clcn3 UTSW 8 60927296 nonsense probably null
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0023:Clcn3 UTSW 8 60933070 splice site probably benign
R0349:Clcn3 UTSW 8 60941348 missense possibly damaging 0.91
R0437:Clcn3 UTSW 8 60934537 missense possibly damaging 0.69
R0784:Clcn3 UTSW 8 60929203 missense probably benign 0.25
R0840:Clcn3 UTSW 8 60929154 missense probably benign 0.22
R1167:Clcn3 UTSW 8 60922788 critical splice donor site probably null
R2193:Clcn3 UTSW 8 60929187 missense possibly damaging 0.56
R3697:Clcn3 UTSW 8 60913123 missense probably benign 0.02
R3736:Clcn3 UTSW 8 60983652 unclassified probably benign
R4676:Clcn3 UTSW 8 60930651 intron probably benign
R4807:Clcn3 UTSW 8 60934530 missense probably damaging 1.00
R5112:Clcn3 UTSW 8 60954552 missense probably benign 0.07
R5200:Clcn3 UTSW 8 60923005 missense probably damaging 0.99
R5652:Clcn3 UTSW 8 60919353 missense possibly damaging 0.81
R5712:Clcn3 UTSW 8 60937298 critical splice donor site probably null
R5731:Clcn3 UTSW 8 60922889 missense possibly damaging 0.46
R5814:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6134:Clcn3 UTSW 8 60934573 missense probably damaging 1.00
R6370:Clcn3 UTSW 8 60923024 missense probably damaging 1.00
R6371:Clcn3 UTSW 8 60937335 missense probably benign 0.06
R6394:Clcn3 UTSW 8 60941291 missense probably damaging 0.99
R6466:Clcn3 UTSW 8 60929561 missense probably damaging 1.00
R6588:Clcn3 UTSW 8 60914827 missense probably benign 0.03
R6750:Clcn3 UTSW 8 60914775 missense possibly damaging 0.93
R7522:Clcn3 UTSW 8 60941412 missense probably benign
R7556:Clcn3 UTSW 8 60929487 missense probably damaging 0.99
R7557:Clcn3 UTSW 8 60937368 missense probably damaging 0.99
R7685:Clcn3 UTSW 8 60933085 missense possibly damaging 0.54
R7887:Clcn3 UTSW 8 60941399 missense probably benign 0.16
R7970:Clcn3 UTSW 8 60941399 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTTGAAACATCTCTCTAGCCCC -3'
(R):5'- GCTTTTACCCAGATGTGTGC -3'

Sequencing Primer
(F):5'- ACATCTCTCTAGCCCCCAGTTTTATG -3'
(R):5'- TAGTCCCAGCTACTTGGGAAG -3'
Posted On2014-08-25