Incidental Mutation 'R1998:Scn7a'
ID 224488
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 040008-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R1998 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 66513613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 1156 (G1156C)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: G1156C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: G1156C

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 88,118,553 (GRCm39) N12K probably damaging Het
2700049A03Rik T A 12: 71,235,393 (GRCm39) S1114R possibly damaging Het
Acot1 T A 12: 84,056,527 (GRCm39) W82R probably damaging Het
Adam22 T C 5: 8,379,995 (GRCm39) D101G probably damaging Het
Adcy9 T C 16: 4,115,276 (GRCm39) D705G probably benign Het
Adgrg3 T G 8: 95,763,296 (GRCm39) L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,641,419 (GRCm39) probably null Het
Brinp1 C T 4: 68,680,790 (GRCm39) G580E probably damaging Het
Brwd1 G A 16: 95,822,488 (GRCm39) T1239M probably damaging Het
Camk1d A T 2: 5,366,836 (GRCm39) Y126* probably null Het
Camta1 T C 4: 151,162,337 (GRCm39) Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,346,709 (GRCm39) L139M probably damaging Het
Cd226 T C 18: 89,225,343 (GRCm39) V80A probably damaging Het
Dgka C T 10: 128,565,808 (GRCm39) V367I probably benign Het
Dnajb13 A T 7: 100,153,817 (GRCm39) I206N probably benign Het
Dst A T 1: 34,295,428 (GRCm39) Q5693L probably damaging Het
Ear6 T A 14: 52,091,672 (GRCm39) I73N probably benign Het
Egr1 A G 18: 34,994,587 (GRCm39) I16V probably benign Het
Eif2s1 T A 12: 78,913,508 (GRCm39) C70S possibly damaging Het
Epcam T C 17: 87,947,902 (GRCm39) V124A probably damaging Het
Erbb2 T A 11: 98,319,779 (GRCm39) C624S probably damaging Het
Fam135b T A 15: 71,324,253 (GRCm39) H1238L probably damaging Het
Fam90a1a A G 8: 22,453,713 (GRCm39) D356G probably benign Het
Fbrsl1 G A 5: 110,524,305 (GRCm39) S127L probably benign Het
Fndc3c1 C T X: 105,464,311 (GRCm39) E1276K probably benign Het
Gbe1 A T 16: 70,365,929 (GRCm39) N702I probably damaging Het
Gm10643 A T 8: 84,791,053 (GRCm39) C20* probably null Het
Gpr156 A G 16: 37,818,270 (GRCm39) N322S possibly damaging Het
Gsdma T A 11: 98,564,520 (GRCm39) I333N probably damaging Het
Gstm1 A G 3: 107,922,127 (GRCm39) F170S probably damaging Het
Hgsnat C T 8: 26,435,280 (GRCm39) W618* probably null Het
Htr5a G A 5: 28,055,887 (GRCm39) V293M possibly damaging Het
Hyal4 A G 6: 24,756,310 (GRCm39) E176G probably benign Het
Iqca1l G A 5: 24,750,004 (GRCm39) R680C probably benign Het
Jag1 T C 2: 136,932,858 (GRCm39) D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 (GRCm39) E378G probably benign Het
Lipo4 A G 19: 33,491,701 (GRCm39) V94A probably damaging Het
Magea10 A T X: 71,426,379 (GRCm39) I205K probably benign Het
Manea A G 4: 26,327,871 (GRCm39) L390P probably damaging Het
Mars1 T A 10: 127,136,347 (GRCm39) K493* probably null Het
Mars1 T C 10: 127,138,740 (GRCm39) I439V probably benign Het
Mboat2 A G 12: 24,996,672 (GRCm39) D225G possibly damaging Het
Mcmbp T A 7: 128,310,887 (GRCm39) E350V probably damaging Het
Mki67 A G 7: 135,307,499 (GRCm39) M459T probably benign Het
Mlf1 G A 3: 67,302,624 (GRCm39) G150R probably damaging Het
Mtmr14 A G 6: 113,254,885 (GRCm39) D294G probably null Het
Nlrp4e A C 7: 23,020,671 (GRCm39) Y386S probably benign Het
Nomo1 A G 7: 45,683,368 (GRCm39) D38G possibly damaging Het
Nudcd2 T C 11: 40,624,844 (GRCm39) W18R probably damaging Het
Or11g26 T A 14: 50,752,813 (GRCm39) C51S probably benign Het
Or3a1b A G 11: 74,012,406 (GRCm39) Y97C probably benign Het
Or52e4 G T 7: 104,706,112 (GRCm39) V220L probably benign Het
Or5d16 G A 2: 87,773,490 (GRCm39) L161F probably benign Het
Or5w16 T C 2: 87,577,316 (GRCm39) Y259H probably damaging Het
Pcnx2 A T 8: 126,613,882 (GRCm39) V523D probably damaging Het
Pkd1 T C 17: 24,791,988 (GRCm39) V1225A probably damaging Het
Plekhh2 T A 17: 84,914,305 (GRCm39) L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,794,885 (GRCm39) D570G probably damaging Het
Prrc2c T A 1: 162,532,487 (GRCm39) probably benign Het
Rai14 C T 15: 10,595,067 (GRCm39) probably null Het
Rap1gap2 A G 11: 74,286,659 (GRCm39) L547P probably benign Het
Rims3 A T 4: 120,748,555 (GRCm39) M259L probably benign Het
Rsbn1l G A 5: 21,107,368 (GRCm39) H549Y probably damaging Het
Sart3 A C 5: 113,885,982 (GRCm39) probably null Het
Sh3rf2 T A 18: 42,274,148 (GRCm39) V406D probably damaging Het
Slitrk6 T C 14: 110,989,255 (GRCm39) I151V probably damaging Het
Smarca2 A T 19: 26,608,493 (GRCm39) Q260L probably benign Het
Smco1 A G 16: 32,092,658 (GRCm39) R110G probably damaging Het
Spef2 T A 15: 9,668,989 (GRCm39) probably null Het
Stab1 T A 14: 30,884,110 (GRCm39) K219* probably null Het
Sulf1 G T 1: 12,929,058 (GRCm39) E869* probably null Het
Susd1 T C 4: 59,349,925 (GRCm39) I504V probably benign Het
Szt2 A G 4: 118,232,924 (GRCm39) probably null Het
Tas1r3 A T 4: 155,947,377 (GRCm39) C103S probably damaging Het
Thg1l C A 11: 45,841,030 (GRCm39) W243L possibly damaging Het
Tlr4 A T 4: 66,758,707 (GRCm39) D500V probably damaging Het
Tmem72 A G 6: 116,693,525 (GRCm39) V5A probably benign Het
Tns4 T G 11: 98,976,529 (GRCm39) M131L probably benign Het
Trim66 C T 7: 109,083,784 (GRCm39) probably null Het
Ttll6 T A 11: 96,030,601 (GRCm39) probably null Het
Ttn A T 2: 76,800,047 (GRCm39) I387N probably damaging Het
Ubqln5 T A 7: 103,777,948 (GRCm39) Q292L probably damaging Het
Vmn1r74 G T 7: 11,581,302 (GRCm39) V201F probably damaging Het
Vmn2r28 G T 7: 5,491,313 (GRCm39) D311E possibly damaging Het
Vtn T A 11: 78,390,542 (GRCm39) V67E probably damaging Het
Xirp2 T A 2: 67,339,393 (GRCm39) F545I probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66,506,536 (GRCm39) missense probably damaging 1.00
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCAAGCAGGATAACTAGGTCTC -3'
(R):5'- CACATTATATTGAAGTGTGGCCAAC -3'

Sequencing Primer
(F):5'- CAGGATAACTAGGTCTCAACTTTTGC -3'
(R):5'- ACCCCACCATTCAGTGTTCTAGAG -3'
Posted On 2014-08-25