Incidental Mutation 'R0143:Hivep2'
ID22449
Institutional Source Beutler Lab
Gene Symbol Hivep2
Ensembl Gene ENSMUSG00000015501
Gene Namehuman immunodeficiency virus type I enhancer binding protein 2
SynonymsShn-2, MIBP1, Schnurri-2, Gm20114
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location13966075-14151374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14129355 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 566 (F566L)
Ref Sequence ENSEMBL: ENSMUSP00000140150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015645] [ENSMUST00000186989] [ENSMUST00000187083] [ENSMUST00000191138]
Predicted Effect probably damaging
Transcript: ENSMUST00000015645
AA Change: F566L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015645
Gene: ENSMUSG00000015501
AA Change: F566L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186989
SMART Domains Protein: ENSMUSP00000140180
Gene: ENSMUSG00000015501

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 7.9e-6 SMART
ZnF_C2H2 217 239 3.1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187083
AA Change: F566L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140290
Gene: ENSMUSG00000015501
AA Change: F566L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191138
AA Change: F566L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140150
Gene: ENSMUSG00000015501
AA Change: F566L

DomainStartEndE-ValueType
low complexity region 177 188 N/A INTRINSIC
ZnF_C2H2 189 211 1.82e-3 SMART
ZnF_C2H2 217 239 7.26e-3 SMART
low complexity region 887 909 N/A INTRINSIC
low complexity region 922 937 N/A INTRINSIC
low complexity region 939 956 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 1499 1521 N/A INTRINSIC
low complexity region 1548 1569 N/A INTRINSIC
ZnF_C2H2 1783 1805 2.24e-3 SMART
ZnF_C2H2 1811 1835 1.98e-4 SMART
low complexity region 1853 1862 N/A INTRINSIC
low complexity region 1883 1910 N/A INTRINSIC
low complexity region 1943 1956 N/A INTRINSIC
low complexity region 2013 2038 N/A INTRINSIC
low complexity region 2090 2103 N/A INTRINSIC
low complexity region 2233 2241 N/A INTRINSIC
low complexity region 2271 2289 N/A INTRINSIC
Meta Mutation Damage Score 0.1946 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of closely related, large, zinc finger-containing transcription factors. The encoded protein regulates transcription by binding to regulatory regions of various cellular and viral genes that maybe involved in growth, development and metastasis. The protein contains the ZAS domain comprised of two widely separated regions of zinc finger motifs, a stretch of highly acidic amino acids and a serine/threonine-rich sequence. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display abnormal thymus anatomy, severely defective positive selection of CD4+ and CD8+ cells, and enhanced T-helper 2 cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Hivep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Hivep2 APN 10 14142244 missense probably damaging 1.00
IGL00963:Hivep2 APN 10 14129347 missense probably damaging 1.00
IGL01066:Hivep2 APN 10 14149024 missense possibly damaging 0.92
IGL01395:Hivep2 APN 10 14132800 critical splice donor site probably null
IGL01474:Hivep2 APN 10 14143662 missense probably damaging 1.00
IGL01481:Hivep2 APN 10 14149237 missense probably benign
IGL01597:Hivep2 APN 10 14149374 nonsense probably null
IGL01719:Hivep2 APN 10 14130523 missense probably damaging 1.00
IGL01952:Hivep2 APN 10 14142331 missense possibly damaging 0.54
IGL02170:Hivep2 APN 10 14127804 missense possibly damaging 0.46
IGL02315:Hivep2 APN 10 14131239 missense probably benign 0.01
IGL02517:Hivep2 APN 10 14131182 missense probably benign 0.01
IGL02535:Hivep2 APN 10 14139497 missense probably damaging 1.00
IGL02539:Hivep2 APN 10 14131878 missense probably damaging 0.97
IGL02637:Hivep2 APN 10 14130708 missense possibly damaging 0.89
IGL02715:Hivep2 APN 10 14131387 missense probably benign 0.03
IGL02948:Hivep2 APN 10 14129013 missense probably benign 0.44
IGL03113:Hivep2 APN 10 14130651 missense probably damaging 1.00
IGL03161:Hivep2 APN 10 14143356 missense probably damaging 1.00
IGL03173:Hivep2 APN 10 14127982 missense possibly damaging 0.75
IGL03310:Hivep2 APN 10 14143667 missense probably damaging 1.00
BB010:Hivep2 UTSW 10 14127837 missense probably damaging 1.00
BB020:Hivep2 UTSW 10 14127837 missense probably damaging 1.00
R0005:Hivep2 UTSW 10 14128749 missense probably damaging 0.99
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0053:Hivep2 UTSW 10 14132121 missense probably damaging 1.00
R0136:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R0172:Hivep2 UTSW 10 14139474 missense probably damaging 1.00
R0226:Hivep2 UTSW 10 14129712 missense probably benign 0.26
R0348:Hivep2 UTSW 10 14129958 missense possibly damaging 0.76
R0352:Hivep2 UTSW 10 14143295 missense possibly damaging 0.74
R0657:Hivep2 UTSW 10 14131878 missense probably benign 0.04
R1710:Hivep2 UTSW 10 14129505 nonsense probably null
R1959:Hivep2 UTSW 10 14132709 missense probably benign 0.02
R2017:Hivep2 UTSW 10 14130757 missense probably damaging 0.96
R2085:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2085:Hivep2 UTSW 10 14139529 nonsense probably null
R2163:Hivep2 UTSW 10 14128226 nonsense probably null
R2206:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2207:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2228:Hivep2 UTSW 10 14128363 missense probably damaging 1.00
R2241:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2242:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2243:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2246:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2247:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2273:Hivep2 UTSW 10 14132443 missense probably benign 0.02
R2357:Hivep2 UTSW 10 14143299 missense probably benign 0.01
R2517:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2519:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2858:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2859:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2916:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R2921:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3051:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3177:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3277:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3620:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3621:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3701:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3802:Hivep2 UTSW 10 14148961 missense possibly damaging 0.94
R3810:Hivep2 UTSW 10 14130357 missense probably benign
R3811:Hivep2 UTSW 10 14130357 missense probably benign
R3817:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3818:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3819:Hivep2 UTSW 10 14143941 missense possibly damaging 0.46
R3836:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3837:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3838:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3839:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3897:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3900:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3932:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3954:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R3957:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4001:Hivep2 UTSW 10 14127732 missense probably damaging 1.00
R4134:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4180:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4248:Hivep2 UTSW 10 14131555 missense probably damaging 1.00
R4416:Hivep2 UTSW 10 14129170 missense probably benign
R4436:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4437:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4474:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4475:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4476:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4636:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4637:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4791:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4792:Hivep2 UTSW 10 14128969 missense probably benign 0.16
R4825:Hivep2 UTSW 10 14131319 missense possibly damaging 0.81
R4955:Hivep2 UTSW 10 14130958 missense probably benign 0.44
R5094:Hivep2 UTSW 10 14132149 missense probably benign
R5129:Hivep2 UTSW 10 14130864 missense probably damaging 1.00
R5163:Hivep2 UTSW 10 14139425 missense probably damaging 1.00
R5255:Hivep2 UTSW 10 14131267 splice site probably null
R5330:Hivep2 UTSW 10 14131420 missense probably damaging 1.00
R5341:Hivep2 UTSW 10 14132592 missense possibly damaging 0.94
R5453:Hivep2 UTSW 10 14128228 missense possibly damaging 0.78
R5513:Hivep2 UTSW 10 14132673 nonsense probably null
R5535:Hivep2 UTSW 10 14131022 missense probably benign 0.00
R5613:Hivep2 UTSW 10 14139495 missense probably damaging 1.00
R5804:Hivep2 UTSW 10 14133775 missense probably benign 0.01
R6074:Hivep2 UTSW 10 14131741 missense probably benign 0.18
R6163:Hivep2 UTSW 10 14129992 missense probably damaging 0.98
R6250:Hivep2 UTSW 10 14131759 missense probably benign 0.01
R6696:Hivep2 UTSW 10 14133759 missense probably benign 0.06
R6754:Hivep2 UTSW 10 14129638 missense probably benign 0.06
R6756:Hivep2 UTSW 10 14132559 missense probably damaging 1.00
R6799:Hivep2 UTSW 10 14129013 missense probably benign 0.28
R6862:Hivep2 UTSW 10 14130583 missense probably damaging 1.00
R6932:Hivep2 UTSW 10 14128501 missense probably damaging 1.00
R6943:Hivep2 UTSW 10 14128314 missense probably damaging 1.00
R7027:Hivep2 UTSW 10 14149577 missense probably damaging 0.99
R7027:Hivep2 UTSW 10 14149578 missense probably damaging 1.00
R7198:Hivep2 UTSW 10 14129966 missense probably benign
R7248:Hivep2 UTSW 10 14131165 missense possibly damaging 0.86
R7256:Hivep2 UTSW 10 14129101 missense probably benign 0.29
R7426:Hivep2 UTSW 10 14131317 missense possibly damaging 0.93
R7427:Hivep2 UTSW 10 14133741 missense possibly damaging 0.94
R7638:Hivep2 UTSW 10 14143851 missense possibly damaging 0.81
R7731:Hivep2 UTSW 10 14149714 missense probably benign
R7740:Hivep2 UTSW 10 14127670 missense probably damaging 1.00
R7797:Hivep2 UTSW 10 14130103 missense probably benign
R7933:Hivep2 UTSW 10 14127837 missense probably damaging 1.00
R8329:Hivep2 UTSW 10 14128267 missense probably damaging 1.00
R8399:Hivep2 UTSW 10 14132434 missense possibly damaging 0.63
Z1177:Hivep2 UTSW 10 14131786 missense probably damaging 1.00
Z1177:Hivep2 UTSW 10 14143307 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAGCCATCCCGTCCTCTGTTAG -3'
(R):5'- GAACCCAGGTAGCTCTGTTTCAGTG -3'

Sequencing Primer
(F):5'- CCCGTCCTCTGTTAGGAATGAAG -3'
(R):5'- TTACGGCAGACATCGTAGTC -3'
Posted On2013-04-16