Incidental Mutation 'R1998:Susd1'
ID224508
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Namesushi domain containing 1
SynonymsGm12528
MMRRC Submission 040008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59314683-59438633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59349925 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 504 (I504V)
Ref Sequence ENSEMBL: ENSMUSP00000103168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
Predicted Effect probably benign
Transcript: ENSMUST00000040166
AA Change: I557V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: I557V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107544
AA Change: I504V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: I504V

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R6081:Susd1 UTSW 4 59411359 missense possibly damaging 0.86
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7161:Susd1 UTSW 4 59329581 missense possibly damaging 0.85
R7172:Susd1 UTSW 4 59315420 splice site probably null
R7891:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
R7974:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAGGCTTCCTTTACCATGACAG -3'
(R):5'- CCCAGGGGCTGAGATTATAGTTATG -3'

Sequencing Primer
(F):5'- GGCTTCCTTTACCATGACAGAAAGC -3'
(R):5'- AGAAGGCATTTGTCCAGG -3'
Posted On2014-08-25