Incidental Mutation 'R0143:Rbms2'
ID22452
Institutional Source Beutler Lab
Gene Symbol Rbms2
Ensembl Gene ENSMUSG00000040043
Gene NameRNA binding motif, single stranded interacting protein 2
SynonymsScr3, 2610315E04Rik
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location128131558-128180297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128137954 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 207 (Q207L)
Ref Sequence ENSEMBL: ENSMUSP00000096742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092033] [ENSMUST00000099139]
Predicted Effect probably benign
Transcript: ENSMUST00000092033
AA Change: Q235L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000089664
Gene: ENSMUSG00000040043
AA Change: Q235L

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
RRM 59 127 3.35e-16 SMART
RRM 138 209 1.94e-12 SMART
low complexity region 347 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099139
AA Change: Q207L

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096742
Gene: ENSMUSG00000040043
AA Change: Q207L

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
RRM 31 99 3.35e-16 SMART
RRM 110 181 1.94e-12 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218884
Meta Mutation Damage Score 0.2463 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. The RBMS proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. This protein was isolated by phenotypic complementation of cdc2 and cdc13 mutants of yeast and is thought to suppress cdc2 and cdc13 mutants through the induction of translation of cdc2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Rbms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Rbms2 APN 10 128143440 missense probably damaging 1.00
IGL03331:Rbms2 APN 10 128133635 unclassified probably benign
R0458:Rbms2 UTSW 10 128151189 missense probably damaging 1.00
R0494:Rbms2 UTSW 10 128133670 missense probably benign 0.00
R1348:Rbms2 UTSW 10 128176345 splice site probably null
R1809:Rbms2 UTSW 10 128138186 missense possibly damaging 0.91
R2059:Rbms2 UTSW 10 128137518 missense probably benign 0.00
R3709:Rbms2 UTSW 10 128143443 missense probably damaging 1.00
R3710:Rbms2 UTSW 10 128143443 missense probably damaging 1.00
R4001:Rbms2 UTSW 10 128151300 missense probably benign 0.03
R5316:Rbms2 UTSW 10 128145737 missense probably damaging 0.98
R5494:Rbms2 UTSW 10 128137691 missense probably damaging 0.98
R5895:Rbms2 UTSW 10 128145687 missense possibly damaging 0.95
R6306:Rbms2 UTSW 10 128151181 critical splice donor site probably null
R7779:Rbms2 UTSW 10 128143446 missense probably damaging 0.99
Z1176:Rbms2 UTSW 10 128137988 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCGCTAAAGAGCGAGTAGACACC -3'
(R):5'- GAGAAGTGTGAAGCCATCATCACCC -3'

Sequencing Primer
(F):5'- TAGACACCAGGGCTCAGC -3'
(R):5'- GTATATAAAGACACCCCCTGGAGTAG -3'
Posted On2013-04-16