Incidental Mutation 'R2035:Xpo4'
ID224533
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Nameexportin 4
Synonyms
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57577521-57665430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57585926 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1036 (C1036S)
Ref Sequence ENSEMBL: ENSMUSP00000086909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089482
AA Change: C1036S

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: C1036S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174545
AA Change: C1036S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: C1036S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4086:Xpo4 UTSW 14 57643033 intron probably benign
R4373:Xpo4 UTSW 14 57591022 nonsense probably null
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57590989 missense probably benign 0.03
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R7895:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R7978:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCCTCGTATTCTATAACTGAG -3'
(R):5'- GAGACACTGCAATCTGGCCTAC -3'

Sequencing Primer
(F):5'- TTCTATAACTGAGCCTAGACTGAGCC -3'
(R):5'- CTGTATTCCTAGCTACAAAAAGTCC -3'
Posted On2014-08-25