Incidental Mutation 'R2035:Zbtb9'
ID224557
Institutional Source Beutler Lab
Gene Symbol Zbtb9
Ensembl Gene ENSMUSG00000079605
Gene Namezinc finger and BTB domain containing 9
Synonyms
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26973167-26976205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26974923 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 434 (R434H)
Ref Sequence ENSEMBL: ENSMUSP00000112778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000120016] [ENSMUST00000133257] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect probably benign
Transcript: ENSMUST00000081285
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120016
AA Change: R434H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112778
Gene: ENSMUSG00000079605
AA Change: R434H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
BTB 48 142 4.08e-21 SMART
low complexity region 144 164 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
ZnF_C2H2 397 419 1.36e-2 SMART
ZnF_C2H2 424 444 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably benign
Transcript: ENSMUST00000228963
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Predicted Effect probably benign
Transcript: ENSMUST00000231853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Zbtb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Zbtb9 APN 17 26975011 unclassified probably benign
IGL02266:Zbtb9 APN 17 26974155 missense probably benign 0.00
IGL03192:Zbtb9 APN 17 26974298 missense probably benign 0.01
PIT4377001:Zbtb9 UTSW 17 26974761 missense probably damaging 1.00
R0655:Zbtb9 UTSW 17 26974100 missense probably damaging 1.00
R1350:Zbtb9 UTSW 17 26974406 missense probably benign 0.05
R1386:Zbtb9 UTSW 17 26974638 missense probably damaging 1.00
R1928:Zbtb9 UTSW 17 26974638 missense probably damaging 1.00
R2208:Zbtb9 UTSW 17 26974124 missense possibly damaging 0.90
R4196:Zbtb9 UTSW 17 26973879 missense probably benign 0.20
R7202:Zbtb9 UTSW 17 26974692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGGTTTGCAGTAAAGCC -3'
(R):5'- GTGAGACCCATACCCAAGAGTAAG -3'

Sequencing Primer
(F):5'- CGGTTTGCAGTAAAGCCGAAAC -3'
(R):5'- CCCAAGAGTAAGGGGTTCATGAC -3'
Posted On2014-08-25