Incidental Mutation 'R0143:Polg2'
ID22458
Institutional Source Beutler Lab
Gene Symbol Polg2
Ensembl Gene ENSMUSG00000020718
Gene Namepolymerase (DNA directed), gamma 2, accessory subunit
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location106768253-106779537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106777526 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 174 (V174L)
Ref Sequence ENSEMBL: ENSMUSP00000021060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000127481] [ENSMUST00000133426] [ENSMUST00000134029] [ENSMUST00000155107]
PDB Structure
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021060
AA Change: V174L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718
AA Change: V174L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021062
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126201
AA Change: W162C
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718
AA Change: W162C

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130172
Predicted Effect probably benign
Transcript: ENSMUST00000133426
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142590
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the processivity subunit of the mitochondrial DNA polymerase gamma. The encoded protein forms a heterotrimer containing one catalytic subunit and two processivity subunits. This protein enhances DNA binding and promotes processive DNA synthesis. Mutations in this gene result in autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and turning, fail to initiate turning, lack mt-Co1 activity, and contain abnormal mitochondria with reduced mtDNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Ankrd34b A G 13: 92,439,760 E500G probably damaging Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Polg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Polg2 APN 11 106777432 splice site probably null
IGL02205:Polg2 APN 11 106779120 missense probably benign 0.09
IGL02850:Polg2 APN 11 106768467 missense probably damaging 1.00
IGL02952:Polg2 APN 11 106772713 missense possibly damaging 0.78
IGL03328:Polg2 APN 11 106768337 missense probably benign 0.40
IGL02835:Polg2 UTSW 11 106775440 missense probably benign
R0109:Polg2 UTSW 11 106777132 splice site probably benign
R0709:Polg2 UTSW 11 106768413 missense probably damaging 1.00
R1385:Polg2 UTSW 11 106768323 missense probably damaging 0.97
R1938:Polg2 UTSW 11 106778961 missense probably damaging 0.98
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R3159:Polg2 UTSW 11 106768337 missense probably benign 0.40
R3776:Polg2 UTSW 11 106779284 missense probably benign 0.01
R3982:Polg2 UTSW 11 106779202 nonsense probably null
R5306:Polg2 UTSW 11 106778970 missense probably damaging 0.98
R5338:Polg2 UTSW 11 106779238 missense possibly damaging 0.95
R7055:Polg2 UTSW 11 106777214 missense probably damaging 1.00
R7146:Polg2 UTSW 11 106772746 missense probably benign 0.01
R7464:Polg2 UTSW 11 106773714 missense probably benign 0.08
R7645:Polg2 UTSW 11 106775593 missense probably benign
Z1176:Polg2 UTSW 11 106773429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCGATGACGCAACCAGA -3'
(R):5'- ATTGATTAAACAGTCTCACCATGTCCCC -3'

Sequencing Primer
(F):5'- caaacaaacaaacaaacaaacaaaAC -3'
(R):5'- ctttgtagccctgactgtcc -3'
Posted On2013-04-16