Incidental Mutation 'R2035:F8'
ID224580
Institutional Source Beutler Lab
Gene Symbol F8
Ensembl Gene ENSMUSG00000031196
Gene Namecoagulation factor VIII
SynonymsFVIII, Cf8, Factor VIII, Cf-8
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R2035 (G1)
Quality Score214
Status Not validated
ChromosomeX
Chromosomal Location75172715-75382615 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ATCTCTCTC to ATCTCTC at 75322998 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033539] [ENSMUST00000114085]
Predicted Effect probably null
Transcript: ENSMUST00000033539
SMART Domains Protein: ENSMUSP00000033539
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.6e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 444 577 8.8e-7 PFAM
low complexity region 1210 1231 N/A INTRINSIC
low complexity region 1268 1278 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
internal_repeat_1 1683 2005 3.96e-46 PROSPERO
FA58C 2007 2156 7.3e-48 SMART
FA58C 2160 2313 2.36e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114085
SMART Domains Protein: ENSMUSP00000109719
Gene: ENSMUSG00000031196

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Cu-oxidase_3 89 203 3.1e-7 PFAM
low complexity region 359 377 N/A INTRINSIC
Pfam:Cu-oxidase_3 446 577 7.4e-7 PFAM
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1198 1208 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
internal_repeat_2 1613 1838 3.99e-33 PROSPERO
internal_repeat_1 1615 1935 1.02e-41 PROSPERO
FA58C 1937 2086 7.3e-48 SMART
FA58C 2090 2243 2.36e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X-linked coagulation disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male hemizygotes and female homozygotes for targeted null mutations produce no factor VIII, but are apparently healthy and fertile. However, affected mice show prolonged, exsanguinating bleeding following tail-clipping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in F8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:F8 APN X 75334180 unclassified probably benign
IGL01079:F8 APN X 75286618 missense probably damaging 0.98
IGL01101:F8 APN X 75287387 missense possibly damaging 0.62
IGL01160:F8 APN X 75288061 missense probably damaging 0.99
IGL01397:F8 APN X 75379539 missense probably benign
IGL02043:F8 APN X 75332641 missense probably benign 0.00
IGL02479:F8 APN X 75288240 missense probably damaging 0.98
IGL02505:F8 APN X 75379598 intron probably benign
IGL02869:F8 APN X 75287381 missense probably benign 0.00
IGL03004:F8 APN X 75212052 missense probably damaging 1.00
R0657:F8 UTSW X 75211416 missense possibly damaging 0.86
R0699:F8 UTSW X 75379624 intron probably benign
R2037:F8 UTSW X 75322998 frame shift probably null
R3436:F8 UTSW X 75267424 splice site probably benign
R3735:F8 UTSW X 75211375 missense probably damaging 1.00
R3736:F8 UTSW X 75211375 missense probably damaging 1.00
R3792:F8 UTSW X 75285365 critical splice donor site probably null
X0009:F8 UTSW X 75287783 missense probably benign 0.36
Z1088:F8 UTSW X 75323149 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAACTCACCTTAATCACTTTTATTGGG -3'
(R):5'- ACTCTAATACTCTGTTTCTGGTTTGAA -3'

Sequencing Primer
(F):5'- CAGGGAATATCTAGAAGTTCAT -3'
(R):5'- TTGAATGTGGATAGGTATAAAGCAC -3'
Posted On2014-08-25