Incidental Mutation 'R2036:Olfr1215'
ID224590
Institutional Source Beutler Lab
Gene Symbol Olfr1215
Ensembl Gene ENSMUSG00000100016
Gene Nameolfactory receptor 1215
SynonymsGA_x6K02T2Q125-50482823-50481885, MOR233-13
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89000021-89006973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89001632 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 219 (V219I)
Ref Sequence ENSEMBL: ENSMUSP00000141134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188399] [ENSMUST00000214809] [ENSMUST00000216271]
Predicted Effect probably benign
Transcript: ENSMUST00000099802
AA Change: V219I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097390
Gene: ENSMUSG00000075108
AA Change: V219I

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.1e-48 PFAM
Pfam:7tm_1 39 286 1.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188399
AA Change: V219I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141134
Gene: ENSMUSG00000100016
AA Change: V219I

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 286 1.9e-25 PFAM
Pfam:7tm_4 138 283 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214809
AA Change: V219I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216271
AA Change: V219I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.4488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Anks1b T C 10: 90,969,853 V431A probably damaging Het
Ap5b1 T C 19: 5,568,869 S106P possibly damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap35 T C 7: 16,563,133 E669G probably damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Helz2 T A 2: 181,237,479 H782L probably benign Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Tmprss11d T A 5: 86,309,269 Y177F probably damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Olfr1215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr1215 APN 2 89001339 utr 3 prime probably benign
IGL02395:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02399:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02409:Olfr1215 APN 2 89001910 missense possibly damaging 0.75
IGL02421:Olfr1215 APN 2 89001344 unclassified probably null
IGL03036:Olfr1215 APN 2 89002115 missense possibly damaging 0.94
R2199:Olfr1215 UTSW 2 89001550 missense probably damaging 0.98
R3930:Olfr1215 UTSW 2 89002033 missense probably benign 0.32
R4990:Olfr1215 UTSW 2 89001472 missense probably damaging 0.97
R5199:Olfr1215 UTSW 2 89001763 missense possibly damaging 0.70
R5368:Olfr1215 UTSW 2 89002091 missense probably damaging 1.00
R5396:Olfr1215 UTSW 2 89002196 missense probably benign 0.15
R6881:Olfr1215 UTSW 2 89001937 missense probably damaging 1.00
R7195:Olfr1215 UTSW 2 89001731 missense
R7425:Olfr1215 UTSW 2 89002200 missense
R7804:Olfr1215 UTSW 2 89001511 missense unknown
R8094:Olfr1215 UTSW 2 89002368 start gained probably benign
Z1088:Olfr1215 UTSW 2 89001838 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATTGAGTAACGGTGTCAAGACATC -3'
(R):5'- AGTGGGGATAGCCTTTGCAG -3'

Sequencing Primer
(F):5'- GAGATGTAGGTCGTGCATA -3'
(R):5'- AGGGGGATTTTTGCATTCCATCATAC -3'
Posted On2014-08-25