Incidental Mutation 'R0143:Ankrd34b'
ID22460
Institutional Source Beutler Lab
Gene Symbol Ankrd34b
Ensembl Gene ENSMUSG00000045034
Gene Nameankyrin repeat domain 34B
Synonyms
MMRRC Submission 038428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0143 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location92425896-92441658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92439760 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 500 (E500G)
Ref Sequence ENSEMBL: ENSMUSP00000126289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061594] [ENSMUST00000165225] [ENSMUST00000168871]
Predicted Effect probably damaging
Transcript: ENSMUST00000061594
AA Change: E500G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054330
Gene: ENSMUSG00000045034
AA Change: E500G

DomainStartEndE-ValueType
ANK 9 38 1.96e3 SMART
ANK 42 79 2.85e-5 SMART
ANK 83 113 1.9e-1 SMART
ANK 117 146 1.99e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165225
Predicted Effect probably damaging
Transcript: ENSMUST00000168871
AA Change: E500G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126289
Gene: ENSMUSG00000045034
AA Change: E500G

DomainStartEndE-ValueType
ANK 9 38 1.96e3 SMART
ANK 42 79 2.85e-5 SMART
ANK 83 113 1.9e-1 SMART
ANK 117 146 1.99e2 SMART
Meta Mutation Damage Score 0.1749 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A T 18: 61,855,217 I145N probably benign Het
Ankrd1 G A 19: 36,119,313 A38V probably benign Het
Arhgef12 T C 9: 43,005,594 T419A probably damaging Het
B3galt2 A T 1: 143,647,334 N403Y possibly damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
C4b G A 17: 34,734,219 probably benign Het
Cacna1e A T 1: 154,448,947 probably null Het
Cdh3 T C 8: 106,511,225 V17A probably benign Het
Cog7 A T 7: 121,951,164 L379Q probably damaging Het
Cul9 T C 17: 46,526,410 N1044S possibly damaging Het
Cyp4b1 C T 4: 115,635,874 D258N probably damaging Het
Ddx39 T C 8: 83,720,550 V113A probably benign Het
Dennd4b A T 3: 90,272,364 H643L probably damaging Het
Dpy19l3 T C 7: 35,714,215 T334A probably benign Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Dtx4 G A 19: 12,486,482 T312I probably damaging Het
Dusp18 C T 11: 3,897,243 R78C probably benign Het
Fes A C 7: 80,383,895 F203V probably benign Het
Fhad1 C A 4: 141,929,646 probably benign Het
Gjb2 T C 14: 57,100,069 silent Het
Gm5828 T C 1: 16,768,355 noncoding transcript Het
Gsdma A C 11: 98,666,254 E65A probably damaging Het
Hck T A 2: 153,134,220 probably null Het
Henmt1 A T 3: 108,953,802 H47L probably damaging Het
Hivep2 T C 10: 14,129,355 F566L probably damaging Het
Hnrnpl T C 7: 28,814,192 probably benign Het
Igsf3 T C 3: 101,435,601 I518T probably damaging Het
Ireb2 T C 9: 54,885,909 F223L probably benign Het
Isoc2a T C 7: 4,891,332 probably null Het
Krt73 T A 15: 101,800,773 R200W probably damaging Het
Lgals9 T A 11: 78,963,535 I308F probably damaging Het
Lrp1 A G 10: 127,593,942 F420L probably damaging Het
Mep1b T C 18: 21,095,107 probably benign Het
Mex3a G T 3: 88,536,255 A213S probably benign Het
Mmp13 T C 9: 7,276,558 F218L probably damaging Het
Ncf1 G T 5: 134,227,137 probably benign Het
Notch2 A G 3: 98,146,117 D2032G probably damaging Het
Olfr1505 A C 19: 13,919,250 I77L probably damaging Het
Olfr491 A G 7: 108,316,995 I34V probably benign Het
Olfr63 T C 17: 33,269,497 S258P probably damaging Het
Pex16 G A 2: 92,380,457 G312D probably damaging Het
Pex5 A T 6: 124,398,489 W525R probably damaging Het
Plcb4 T A 2: 135,976,211 I799N probably damaging Het
Poldip3 G A 15: 83,127,943 L372F probably damaging Het
Polg2 C A 11: 106,777,526 V174L probably benign Het
Prrt4 C G 6: 29,170,671 G594A probably damaging Het
Prss1 A G 6: 41,463,588 D199G probably damaging Het
Rbms2 T A 10: 128,137,954 Q207L probably benign Het
Retreg2 A G 1: 75,146,430 D334G possibly damaging Het
Slc6a15 T G 10: 103,418,068 C622G probably benign Het
Spdya T A 17: 71,558,640 D84E probably damaging Het
Stat3 A T 11: 100,895,156 S432T possibly damaging Het
Tiam1 A T 16: 89,898,200 V123E probably benign Het
Tnpo3 A G 6: 29,565,652 probably benign Het
Tnrc6c A C 11: 117,752,985 N1481H probably damaging Het
Top3b T C 16: 16,883,525 S234P probably damaging Het
Tor1aip2 A T 1: 156,059,548 T10S probably benign Het
Tpsab1 T A 17: 25,343,444 H303L probably benign Het
Traf3 T A 12: 111,261,576 V407D probably damaging Het
Trim33 T A 3: 103,352,101 D1035E probably benign Het
Ttc38 T C 15: 85,853,719 V402A possibly damaging Het
Ube4b C T 4: 149,355,457 R646H possibly damaging Het
Usp8 C A 2: 126,755,089 probably benign Het
Zdbf2 A T 1: 63,308,074 I1871F probably benign Het
Zfp345 T A 2: 150,472,555 Q354L probably benign Het
Zfp462 C A 4: 55,023,402 probably benign Het
Zfp81 G A 17: 33,335,121 H240Y possibly damaging Het
Zfp830 A G 11: 82,765,168 D266G possibly damaging Het
Other mutations in Ankrd34b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Ankrd34b APN 13 92438787 missense probably benign 0.00
IGL02684:Ankrd34b APN 13 92438508 missense probably damaging 0.99
IGL02695:Ankrd34b APN 13 92439612 missense possibly damaging 0.91
IGL03302:Ankrd34b APN 13 92439643 missense possibly damaging 0.90
R1874:Ankrd34b UTSW 13 92439556 missense probably damaging 0.99
R2138:Ankrd34b UTSW 13 92439406 missense probably damaging 0.97
R2504:Ankrd34b UTSW 13 92439061 unclassified probably null
R4782:Ankrd34b UTSW 13 92438305 missense probably damaging 0.98
R6123:Ankrd34b UTSW 13 92439076 missense probably damaging 1.00
R7159:Ankrd34b UTSW 13 92439462 missense probably benign 0.00
R7238:Ankrd34b UTSW 13 92438631 missense possibly damaging 0.77
R7367:Ankrd34b UTSW 13 92438287 missense probably benign 0.00
R8005:Ankrd34b UTSW 13 92438722 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCCGCCCTTGAATGTGAATCC -3'
(R):5'- ACTGTGAACACTGCTTGCTCTGTC -3'

Sequencing Primer
(F):5'- GAATGTGAATCCTCACCCTCC -3'
(R):5'- CCCTCAGAAGCTATGTATTAAGCTG -3'
Posted On2013-04-16