Incidental Mutation 'R1998:2700049A03Rik'
ID224611
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 040008-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71188619 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1114 (S1114R)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect unknown
Transcript: ENSMUST00000045907
AA Change: S1114R
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: S1114R

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: S1114R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: S1114R

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I504V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGCTGAAACGGCTTTAAATG -3'
(R):5'- TTACACCGCTCTTGGGTGAG -3'

Sequencing Primer
(F):5'- AATTGAACTCAGGGCCTCTG -3'
(R):5'- CGCTCTTGGGTGAGGAAGC -3'
Posted On2014-08-25