Incidental Mutation 'R2036:Tmprss11d'
ID224622
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86309269 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 177 (Y177F)
Ref Sequence ENSEMBL: ENSMUSP00000113079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031175
AA Change: Y315F

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: Y315F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122377
AA Change: Y177F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259
AA Change: Y177F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 47 273 1.29e-86 SMART
Meta Mutation Damage Score 0.1964 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Anks1b T C 10: 90,969,853 V431A probably damaging Het
Ap5b1 T C 19: 5,568,869 S106P possibly damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap35 T C 7: 16,563,133 E669G probably damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Helz2 T A 2: 181,237,479 H782L probably benign Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1215 C T 2: 89,001,632 V219I probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
R7627:Tmprss11d UTSW 5 86309506 missense possibly damaging 0.73
R7742:Tmprss11d UTSW 5 86303634 missense probably damaging 0.98
R7937:Tmprss11d UTSW 5 86309490 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTCCTCATCTGAGAACTGACAAG -3'
(R):5'- GCTATTTTAGCCCACGACGG -3'

Sequencing Primer
(F):5'- GACTTAGTGGTATAAGCCTGTATCC -3'
(R):5'- GGTACAGCTCCGTAACTCGTGAC -3'
Posted On2014-08-25