Incidental Mutation 'R2036:Arhgap35'
ID224638
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16563133 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 669 (E669G)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: E669G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: E669G

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: E669G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: E669G

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Meta Mutation Damage Score 0.7281 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Anks1b T C 10: 90,969,853 V431A probably damaging Het
Ap5b1 T C 19: 5,568,869 S106P possibly damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Helz2 T A 2: 181,237,479 H782L probably benign Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1215 C T 2: 89,001,632 V219I probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Tmprss11d T A 5: 86,309,269 Y177F probably damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4661:Arhgap35 UTSW 7 16564738 missense probably damaging 1.00
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
R8101:Arhgap35 UTSW 7 16562319 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGCGTCCATAACCAATGCC -3'
(R):5'- TGGCCAATGAAATTCGAGCTC -3'

Sequencing Primer
(F):5'- ACACACTGAAGTTTGCTGGC -3'
(R):5'- GCCAATGAAATTCGAGCTCTTTGTAC -3'
Posted On2014-08-25