Incidental Mutation 'R1998:Cd226'
ID224657
Institutional Source Beutler Lab
Gene Symbol Cd226
Ensembl Gene ENSMUSG00000034028
Gene NameCD226 antigen
SynonymsTLiSA1, DNAM-1, Pta1, DNAM1
MMRRC Submission 040008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1998 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location89197431-89270201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89207219 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 80 (V80A)
Ref Sequence ENSEMBL: ENSMUSP00000043551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037142] [ENSMUST00000097496]
Predicted Effect probably damaging
Transcript: ENSMUST00000037142
AA Change: V80A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043551
Gene: ENSMUSG00000034028
AA Change: V80A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 22 126 4.46e-1 SMART
IG 138 243 9.26e-8 SMART
transmembrane domain 252 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097496
SMART Domains Protein: ENSMUSP00000095104
Gene: ENSMUSG00000034028

DomainStartEndE-ValueType
IG 25 130 9.26e-8 SMART
transmembrane domain 139 161 N/A INTRINSIC
Meta Mutation Damage Score 0.8553 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. The protein mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired NK cell cytolysis and increased incidence of tumor formation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T G 5: 87,970,694 N12K probably damaging Het
2700049A03Rik T A 12: 71,188,619 S1114R possibly damaging Het
4931409K22Rik G A 5: 24,545,006 R680C probably benign Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adam22 T C 5: 8,329,995 D101G probably damaging Het
Adcy9 T C 16: 4,297,412 D705G probably benign Het
Adgrg3 T G 8: 95,036,668 L244V probably damaging Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Brinp1 C T 4: 68,762,553 G580E probably damaging Het
Brwd1 G A 16: 96,021,288 T1239M probably damaging Het
Camk1d A T 2: 5,362,025 Y126* probably null Het
Camta1 T C 4: 151,077,880 Y1560C probably damaging Het
Cbfa2t2 T A 2: 154,504,789 L139M probably damaging Het
Dgka C T 10: 128,729,939 V367I probably benign Het
Dnajb13 A T 7: 100,504,610 I206N probably benign Het
Dst A T 1: 34,256,347 Q5693L probably damaging Het
Ear6 T A 14: 51,854,215 I73N probably benign Het
Egr1 A G 18: 34,861,534 I16V probably benign Het
Eif2s1 T A 12: 78,866,734 C70S possibly damaging Het
Epcam T C 17: 87,640,474 V124A probably damaging Het
Erbb2 T A 11: 98,428,953 C624S probably damaging Het
Fam135b T A 15: 71,452,404 H1238L probably damaging Het
Fam90a1a A G 8: 21,963,697 D356G probably benign Het
Fbrsl1 G A 5: 110,376,439 S127L probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Gbe1 A T 16: 70,569,041 N702I probably damaging Het
Gm10643 A T 8: 84,064,424 C20* probably null Het
Gpr156 A G 16: 37,997,908 N322S possibly damaging Het
Gsdma T A 11: 98,673,694 I333N probably damaging Het
Gstm1 A G 3: 108,014,811 F170S probably damaging Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Hyal4 A G 6: 24,756,311 E176G probably benign Het
Jag1 T C 2: 137,090,938 D546G probably damaging Het
Kbtbd3 A G 9: 4,330,760 E378G probably benign Het
Lipo4 A G 19: 33,514,301 V94A probably damaging Het
Magea10 A T X: 72,382,773 I205K probably benign Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mars T A 10: 127,300,478 K493* probably null Het
Mars T C 10: 127,302,871 I439V probably benign Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Mcmbp T A 7: 128,709,163 E350V probably damaging Het
Mki67 A G 7: 135,705,770 M459T probably benign Het
Mlf1 G A 3: 67,395,291 G150R probably damaging Het
Mtmr14 A G 6: 113,277,924 D294G probably null Het
Nlrp4e A C 7: 23,321,246 Y386S probably benign Het
Nomo1 A G 7: 46,033,944 D38G possibly damaging Het
Nudcd2 T C 11: 40,734,017 W18R probably damaging Het
Olfr1140 T C 2: 87,746,972 Y259H probably damaging Het
Olfr1155 G A 2: 87,943,146 L161F probably benign Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr677 G T 7: 105,056,905 V220L probably benign Het
Olfr742 T A 14: 50,515,356 C51S probably benign Het
Pcnx2 A T 8: 125,887,143 V523D probably damaging Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhh2 T A 17: 84,606,877 L1236Q possibly damaging Het
Ppp2r1b A G 9: 50,883,585 D570G probably damaging Het
Prrc2c T A 1: 162,704,918 probably benign Het
Rai14 C T 15: 10,594,981 probably null Het
Rap1gap2 A G 11: 74,395,833 L547P probably benign Het
Rims3 A T 4: 120,891,358 M259L probably benign Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Sart3 A C 5: 113,747,921 probably null Het
Scn7a C A 2: 66,683,269 G1156C probably damaging Het
Sh3rf2 T A 18: 42,141,083 V406D probably damaging Het
Slitrk6 T C 14: 110,751,823 I151V probably damaging Het
Smarca2 A T 19: 26,631,093 Q260L probably benign Het
Smco1 A G 16: 32,273,840 R110G probably damaging Het
Spef2 T A 15: 9,668,903 probably null Het
Stab1 T A 14: 31,162,153 K219* probably null Het
Sulf1 G T 1: 12,858,834 E869* probably null Het
Susd1 T C 4: 59,349,925 I504V probably benign Het
Szt2 A G 4: 118,375,727 probably null Het
Tas1r3 A T 4: 155,862,920 C103S probably damaging Het
Thg1l C A 11: 45,950,203 W243L possibly damaging Het
Tlr4 A T 4: 66,840,470 D500V probably damaging Het
Tmem72 A G 6: 116,716,564 V5A probably benign Het
Tns4 T G 11: 99,085,703 M131L probably benign Het
Trim66 C T 7: 109,484,577 probably null Het
Ttll6 T A 11: 96,139,775 probably null Het
Ttn A T 2: 76,969,703 I387N probably damaging Het
Ubqln5 T A 7: 104,128,741 Q292L probably damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Vmn2r28 G T 7: 5,488,314 D311E possibly damaging Het
Vtn T A 11: 78,499,716 V67E probably damaging Het
Xirp2 T A 2: 67,509,049 F545I probably damaging Het
Other mutations in Cd226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Cd226 APN 18 89269063 missense probably damaging 1.00
IGL02292:Cd226 APN 18 89207092 missense possibly damaging 0.55
IGL02298:Cd226 APN 18 89207051 missense probably damaging 1.00
IGL02408:Cd226 APN 18 89207327 missense probably benign
R0179:Cd226 UTSW 18 89207139 missense probably benign 0.00
R0558:Cd226 UTSW 18 89207214 missense probably benign 0.30
R0602:Cd226 UTSW 18 89269011 missense probably benign 0.00
R0744:Cd226 UTSW 18 89207020 intron probably benign
R0833:Cd226 UTSW 18 89207020 intron probably benign
R1125:Cd226 UTSW 18 89267922 missense probably benign
R1352:Cd226 UTSW 18 89247174 missense probably damaging 1.00
R1355:Cd226 UTSW 18 89247023 missense probably benign 0.10
R1370:Cd226 UTSW 18 89247023 missense probably benign 0.10
R2004:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2006:Cd226 UTSW 18 89247311 missense probably benign 0.03
R2045:Cd226 UTSW 18 89207362 missense probably benign 0.10
R2354:Cd226 UTSW 18 89246983 critical splice acceptor site probably null
R2518:Cd226 UTSW 18 89207327 missense probably benign
R4603:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R4804:Cd226 UTSW 18 89207168 missense possibly damaging 0.89
R5964:Cd226 UTSW 18 89207183 missense probably benign 0.02
R5999:Cd226 UTSW 18 89207219 missense probably damaging 1.00
R7205:Cd226 UTSW 18 89247198 missense probably damaging 1.00
R7456:Cd226 UTSW 18 89206623 missense probably damaging 0.96
R7509:Cd226 UTSW 18 89247071 missense probably benign 0.10
R7714:Cd226 UTSW 18 89247309 missense probably damaging 1.00
X0024:Cd226 UTSW 18 89263285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAACAGTTCGGCTTTCTG -3'
(R):5'- ACTTGCACTCAGAAATGACAGC -3'

Sequencing Primer
(F):5'- CAACAGTTCGGCTTTCTGAGACTATG -3'
(R):5'- TGCACTCAGAAATGACAGCAATTAAG -3'
Posted On2014-08-25