Incidental Mutation 'R1999:Ambp'
ID224694
Institutional Source Beutler Lab
Gene Symbol Ambp
Ensembl Gene ENSMUSG00000028356
Gene Namealpha 1 microglobulin/bikunin
SynonymsUTI, Urinary Trypsin Inhibitor, ulinastatin, Itil, HI-30, Intin4, ASPI
MMRRC Submission 040009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1999 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63143275-63154799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63149429 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 181 (M181I)
Ref Sequence ENSEMBL: ENSMUSP00000030041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030041] [ENSMUST00000142901]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030041
AA Change: M181I

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030041
Gene: ENSMUSG00000028356
AA Change: M181I

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Pfam:Lipocalin 40 185 4.4e-32 PFAM
KU 228 281 1.55e-20 SMART
KU 284 337 4.58e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142901
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a fusion protein that undergoes proteolytic processing to generate two mature proteins: alpha-1-microglobulin (A1m) is a heme-binding plasma glycoprotein of the lipocalin superfamily of proteins that bind to hydrophobic molecules, whereas bikunin belongs to the superfamily of Kunitz-type protease inhibitors. The transgenic mice specifically lacking bikunin, but not A1m, exhibit female infertility and an increased sensitivity to lung metastasis. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female homozygotes for targeted null mutations exhibit reduced ovulation rates, oocytes lacking a zona pellucida, and a very low fertilization rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,908,211 T487I probably damaging Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anln A G 9: 22,333,052 *1122Q probably null Het
Apc2 C T 10: 80,309,160 T635I probably damaging Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Ceacam5 A T 7: 17,747,247 K306N possibly damaging Het
Cep295nl T C 11: 118,333,089 R310G probably damaging Het
Ces2h A G 8: 105,020,345 T538A probably benign Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Diaph3 T A 14: 86,984,866 D405V possibly damaging Het
Dync1h1 T C 12: 110,666,423 probably null Het
Epha7 C T 4: 28,938,686 Q514* probably null Het
Etfb C T 7: 43,454,563 L141F probably benign Het
Fat1 T C 8: 44,952,393 V727A probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm9268 A T 7: 43,047,459 I647F probably damaging Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Kcnq5 T C 1: 21,402,204 S811G probably null Het
Kcnt1 T A 2: 25,892,360 H156Q probably benign Het
Kif1a T C 1: 93,060,795 N507S probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Medag T A 5: 149,427,252 F64Y probably damaging Het
Mtmr6 T A 14: 60,293,407 S331R probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Nomo1 T C 7: 46,056,727 S502P possibly damaging Het
Olfr1076 T A 2: 86,508,745 Y95* probably null Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Otof T A 5: 30,388,772 E427D probably benign Het
Pclo T C 5: 14,677,080 probably benign Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rad21l T C 2: 151,654,701 probably null Het
Rbbp6 T C 7: 122,990,352 V459A probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Slc44a5 T C 3: 154,258,493 F499L possibly damaging Het
Slitrk3 C T 3: 73,049,964 V492I probably benign Het
Spef2 T A 15: 9,668,903 probably null Het
Ssc5d A T 7: 4,942,714 D915V possibly damaging Het
Stard9 A G 2: 120,692,868 D668G probably damaging Het
Sycp2l A G 13: 41,118,304 D73G probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem8b G A 4: 43,681,300 C439Y probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Other mutations in Ambp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Ambp APN 4 63154018 missense possibly damaging 0.93
IGL00769:Ambp APN 4 63144165 missense probably damaging 0.99
IGL01400:Ambp APN 4 63152722 missense probably damaging 1.00
IGL01646:Ambp APN 4 63148740 missense probably benign 0.04
IGL02338:Ambp APN 4 63143697 missense probably damaging 1.00
IGL02796:Ambp APN 4 63153932 splice site probably benign
PIT4131001:Ambp UTSW 4 63144265 missense probably damaging 1.00
PIT4791001:Ambp UTSW 4 63154061 start gained probably benign
R0885:Ambp UTSW 4 63151468 missense probably damaging 0.98
R1725:Ambp UTSW 4 63144276 missense possibly damaging 0.92
R2023:Ambp UTSW 4 63151465 missense probably damaging 1.00
R2290:Ambp UTSW 4 63143687 missense probably damaging 1.00
R3436:Ambp UTSW 4 63149484 missense probably benign 0.03
R3437:Ambp UTSW 4 63149484 missense probably benign 0.03
R4078:Ambp UTSW 4 63150443 missense probably damaging 0.98
R4409:Ambp UTSW 4 63152647 missense probably damaging 1.00
R4979:Ambp UTSW 4 63152651 missense probably benign 0.07
R6738:Ambp UTSW 4 63149474 missense probably benign
R6818:Ambp UTSW 4 63154006 nonsense probably null
R6890:Ambp UTSW 4 63150359 missense probably benign 0.44
R8022:Ambp UTSW 4 63144197 missense probably damaging 1.00
X0057:Ambp UTSW 4 63149505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTGCTGCCTCTGCTAGTG -3'
(R):5'- ACCCATCTTTCAATGGTATGCC -3'

Sequencing Primer
(F):5'- GCATGTTCTGAGACTTGGGCAAAC -3'
(R):5'- GAGTTAATGGGCCAGTCCTTTCC -3'
Posted On2014-08-25