Incidental Mutation 'R2036:Ap5b1'
ID224697
Institutional Source Beutler Lab
Gene Symbol Ap5b1
Ensembl Gene ENSMUSG00000049562
Gene Nameadaptor-related protein complex 5, beta 1 subunit
SynonymsGm962
MMRRC Submission 040043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R2036 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5568074-5571261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5568869 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 106 (S106P)
Ref Sequence ENSEMBL: ENSMUSP00000094042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096318
AA Change: S106P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094042
Gene: ENSMUSG00000049562
AA Change: S106P

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 68 75 N/A INTRINSIC
low complexity region 84 104 N/A INTRINSIC
low complexity region 114 136 N/A INTRINSIC
low complexity region 185 199 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
low complexity region 511 524 N/A INTRINSIC
low complexity region 616 644 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,743,254 D1029G probably damaging Het
4930415H17Rik C T 11: 99,685,532 C3Y unknown Het
Abr G T 11: 76,452,350 T547K probably benign Het
Akr1c21 T C 13: 4,576,306 Y110H probably damaging Het
Ankar T A 1: 72,666,530 K556* probably null Het
Anks1b T C 10: 90,969,853 V431A probably damaging Het
Arhgap17 T C 7: 123,318,494 N156D possibly damaging Het
Arhgap35 T C 7: 16,563,133 E669G probably damaging Het
Arhgap44 T C 11: 65,041,492 M201V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atg4c C T 4: 99,218,139 T112M possibly damaging Het
Bcl11a A T 11: 24,164,087 N477Y possibly damaging Het
Brinp3 A T 1: 146,701,841 I205F possibly damaging Het
Capza2 T C 6: 17,660,778 F159S probably damaging Het
Cd40 T C 2: 165,062,301 C61R probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cdh23 A G 10: 60,466,043 I415T possibly damaging Het
Clnk A T 5: 38,752,800 probably null Het
Ctcfl C T 2: 173,101,985 R524Q possibly damaging Het
Cyb5r4 T G 9: 87,042,879 probably benign Het
Ddb1 T A 19: 10,610,822 probably benign Het
Ddx51 C A 5: 110,656,625 Q526K probably benign Het
Dennd6a A T 14: 26,608,119 Q56L probably damaging Het
Dhdds T C 4: 133,971,099 E142G probably damaging Het
Dnaic1 A G 4: 41,632,225 H553R probably damaging Het
Fryl T C 5: 73,022,544 N2908S probably benign Het
Fryl C A 5: 73,107,962 probably null Het
Fut9 A G 4: 25,620,322 I164T probably damaging Het
Gba2 G A 4: 43,568,118 probably benign Het
Gm11627 C T 11: 102,576,754 V33I unknown Het
Helz2 T A 2: 181,237,479 H782L probably benign Het
Kcnmb3 A G 3: 32,472,382 V220A probably damaging Het
Kif20a T C 18: 34,628,462 S303P possibly damaging Het
Kif22 A T 7: 127,030,954 V470E possibly damaging Het
Majin C T 19: 6,213,312 T132M probably benign Het
Mboat7 A G 7: 3,685,672 probably null Het
Mkrn2 C A 6: 115,611,914 P206Q probably benign Het
Mphosph9 G A 5: 124,304,211 T358M probably damaging Het
Nkd1 A G 8: 88,591,677 D210G probably damaging Het
Olfr1215 C T 2: 89,001,632 V219I probably damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Olfr1411 A T 1: 92,596,606 E29V probably benign Het
Olfr1443 G C 19: 12,680,801 G231A probably damaging Het
Olfr291 G T 7: 84,856,358 probably benign Het
Olfr494 T A 7: 108,367,740 N83K probably benign Het
Olfr781 G A 10: 129,333,672 D264N probably benign Het
Pi4ka A G 16: 17,303,112 Y63H probably damaging Het
Plekha1 A G 7: 130,902,192 R210G probably damaging Het
Ppp2r2c C T 5: 36,952,404 T369I possibly damaging Het
Rmnd1 T C 10: 4,407,884 D12G probably damaging Het
Rtn2 A G 7: 19,293,739 K120E probably damaging Het
Sh3tc1 A G 5: 35,716,164 S30P probably benign Het
Tln2 T C 9: 67,272,704 E795G possibly damaging Het
Tmprss11d T A 5: 86,309,269 Y177F probably damaging Het
Trrap C A 5: 144,828,562 D2529E probably benign Het
Vmn2r58 A G 7: 41,863,993 Y409H probably benign Het
Wdr72 T A 9: 74,151,594 V323D probably damaging Het
Other mutations in Ap5b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Ap5b1 APN 19 5570979 nonsense probably null
IGL02121:Ap5b1 APN 19 5570787 missense possibly damaging 0.92
R1513:Ap5b1 UTSW 19 5569864 nonsense probably null
R2004:Ap5b1 UTSW 19 5570474 missense possibly damaging 0.83
R2282:Ap5b1 UTSW 19 5569637 missense possibly damaging 0.66
R3441:Ap5b1 UTSW 19 5569983 missense probably benign
R3835:Ap5b1 UTSW 19 5568890 missense possibly damaging 0.66
R4241:Ap5b1 UTSW 19 5568797 missense possibly damaging 0.92
R5324:Ap5b1 UTSW 19 5569835 missense possibly damaging 0.66
R5359:Ap5b1 UTSW 19 5569098 missense possibly damaging 0.83
R7102:Ap5b1 UTSW 19 5570187 missense possibly damaging 0.92
R7132:Ap5b1 UTSW 19 5569384 nonsense probably null
R8548:Ap5b1 UTSW 19 5571095 missense possibly damaging 0.46
Z1088:Ap5b1 UTSW 19 5570424 missense possibly damaging 0.82
Z1177:Ap5b1 UTSW 19 5570928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATATGGTTGCTTCATACTACC -3'
(R):5'- GGCTTACAGCGCTCAAGTTC -3'

Sequencing Primer
(F):5'- ATATGGTTGCTTCATACTACCGCATG -3'
(R):5'- GTTCTCCAAGGCATTCACAGG -3'
Posted On2014-08-25