Mutagenetix > Incidental Mutations

Incidental Mutation 'R0143:Cul9'

22471

Institutional Source

Beutler Lab

Gene Symbol

Cul9

Ensembl Gene

ENSMUSG00000040327

Gene Name

cullin 9

Synonyms

1810035I07Rik, Parc

MMRRC Submission

038428-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R0143 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

46500572-46546388 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46526410 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1044 (N1044S)

Ref Sequence

ENSEMBL: ENSMUSP00000138418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]

Predicted Effect

probably benign
Transcript: ENSMUST00000066026
AA Change: N1044S

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: N1044S

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	441	1e-35	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	2e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
low complexity region	2503	2520	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181301

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182315

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182451

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182485
AA Change: N1044S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: N1044S

Domain	Start	End	E-Value	Type
low complexity region	46	61	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	345	357	N/A	INTRINSIC
Pfam:Cul7	367	442	1.4e-33	PFAM
low complexity region	447	460	N/A	INTRINSIC
low complexity region	525	540	N/A	INTRINSIC
low complexity region	845	860	N/A	INTRINSIC
low complexity region	873	880	N/A	INTRINSIC
APC10	1166	1325	1.97e-56	SMART
low complexity region	1437	1450	N/A	INTRINSIC
low complexity region	1563	1578	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
Cullin_Nedd8	1867	1950	7.55e-6	SMART
Blast:RING	2074	2122	3e-13	BLAST
IBR	2144	2207	8.99e-14	SMART
IBR	2228	2283	4.66e-2	SMART
coiled coil region	2461	2497	N/A	INTRINSIC
low complexity region	2513	2530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183163

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (76/78)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	A	T	18: 61,855,217	I145N	probably benign	Het
Ankrd1	G	A	19: 36,119,313	A38V	probably benign	Het
Ankrd34b	A	G	13: 92,439,760	E500G	probably damaging	Het
Arhgef12	T	C	9: 43,005,594	T419A	probably damaging	Het
B3galt2	A	T	1: 143,647,334	N403Y	possibly damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
C4b	G	A	17: 34,734,219		probably benign	Het
Cacna1e	A	T	1: 154,448,947		probably null	Het
Cdh3	T	C	8: 106,511,225	V17A	probably benign	Het
Cog7	A	T	7: 121,951,164	L379Q	probably damaging	Het
Cyp4b1	C	T	4: 115,635,874	D258N	probably damaging	Het
Ddx39	T	C	8: 83,720,550	V113A	probably benign	Het
Dennd4b	A	T	3: 90,272,364	H643L	probably damaging	Het
Dpy19l3	T	C	7: 35,714,215	T334A	probably benign	Het
Dsg3	T	C	18: 20,536,825	L632S	probably damaging	Het
Dtx4	G	A	19: 12,486,482	T312I	probably damaging	Het
Dusp18	C	T	11: 3,897,243	R78C	probably benign	Het
Fes	A	C	7: 80,383,895	F203V	probably benign	Het
Fhad1	C	A	4: 141,929,646		probably benign	Het
Gjb2	T	C	14: 57,100,069		silent	Het
Gm5828	T	C	1: 16,768,355		noncoding transcript	Het
Gsdma	A	C	11: 98,666,254	E65A	probably damaging	Het
Hck	T	A	2: 153,134,220		probably null	Het
Henmt1	A	T	3: 108,953,802	H47L	probably damaging	Het
Hivep2	T	C	10: 14,129,355	F566L	probably damaging	Het
Hnrnpl	T	C	7: 28,814,192		probably benign	Het
Igsf3	T	C	3: 101,435,601	I518T	probably damaging	Het
Ireb2	T	C	9: 54,885,909	F223L	probably benign	Het
Isoc2a	T	C	7: 4,891,332		probably null	Het
Krt73	T	A	15: 101,800,773	R200W	probably damaging	Het
Lgals9	T	A	11: 78,963,535	I308F	probably damaging	Het
Lrp1	A	G	10: 127,593,942	F420L	probably damaging	Het
Mep1b	T	C	18: 21,095,107		probably benign	Het
Mex3a	G	T	3: 88,536,255	A213S	probably benign	Het
Mmp13	T	C	9: 7,276,558	F218L	probably damaging	Het
Ncf1	G	T	5: 134,227,137		probably benign	Het
Notch2	A	G	3: 98,146,117	D2032G	probably damaging	Het
Olfr1505	A	C	19: 13,919,250	I77L	probably damaging	Het
Olfr491	A	G	7: 108,316,995	I34V	probably benign	Het
Olfr63	T	C	17: 33,269,497	S258P	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Pex5	A	T	6: 124,398,489	W525R	probably damaging	Het
Plcb4	T	A	2: 135,976,211	I799N	probably damaging	Het
Poldip3	G	A	15: 83,127,943	L372F	probably damaging	Het
Polg2	C	A	11: 106,777,526	V174L	probably benign	Het
Prrt4	C	G	6: 29,170,671	G594A	probably damaging	Het
Prss1	A	G	6: 41,463,588	D199G	probably damaging	Het
Rbms2	T	A	10: 128,137,954	Q207L	probably benign	Het
Retreg2	A	G	1: 75,146,430	D334G	possibly damaging	Het
Slc6a15	T	G	10: 103,418,068	C622G	probably benign	Het
Spdya	T	A	17: 71,558,640	D84E	probably damaging	Het
Stat3	A	T	11: 100,895,156	S432T	possibly damaging	Het
Tiam1	A	T	16: 89,898,200	V123E	probably benign	Het
Tnpo3	A	G	6: 29,565,652		probably benign	Het
Tnrc6c	A	C	11: 117,752,985	N1481H	probably damaging	Het
Top3b	T	C	16: 16,883,525	S234P	probably damaging	Het
Tor1aip2	A	T	1: 156,059,548	T10S	probably benign	Het
Tpsab1	T	A	17: 25,343,444	H303L	probably benign	Het
Traf3	T	A	12: 111,261,576	V407D	probably damaging	Het
Trim33	T	A	3: 103,352,101	D1035E	probably benign	Het
Ttc38	T	C	15: 85,853,719	V402A	possibly damaging	Het
Ube4b	C	T	4: 149,355,457	R646H	possibly damaging	Het
Usp8	C	A	2: 126,755,089		probably benign	Het
Zdbf2	A	T	1: 63,308,074	I1871F	probably benign	Het
Zfp345	T	A	2: 150,472,555	Q354L	probably benign	Het
Zfp462	C	A	4: 55,023,402		probably benign	Het
Zfp81	G	A	17: 33,335,121	H240Y	possibly damaging	Het
Zfp830	A	G	11: 82,765,168	D266G	possibly damaging	Het

Other mutations in Cul9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Cul9	APN	17	46525709	missense	probably damaging	1.00
IGL00330:Cul9	APN	17	46510841	splice site	probably benign
IGL00726:Cul9	APN	17	46528096	missense	probably damaging	1.00
IGL01020:Cul9	APN	17	46539023	missense	probably damaging	1.00
IGL01358:Cul9	APN	17	46538314	missense	probably damaging	1.00
IGL01410:Cul9	APN	17	46528646	missense	probably damaging	0.99
IGL01781:Cul9	APN	17	46539304	missense	probably benign
IGL01873:Cul9	APN	17	46502452	missense	probably damaging	0.99
IGL02117:Cul9	APN	17	46540375	missense	probably benign	0.00
IGL02300:Cul9	APN	17	46521032	splice site	probably benign
IGL02426:Cul9	APN	17	46523258	missense	possibly damaging	0.95
IGL02427:Cul9	APN	17	46502632	missense	possibly damaging	0.69
IGL02496:Cul9	APN	17	46540376	missense	possibly damaging	0.72
IGL03008:Cul9	APN	17	46502697	splice site	probably benign
IGL03059:Cul9	APN	17	46538987	missense	probably damaging	0.98
IGL03302:Cul9	APN	17	46526640	missense	probably damaging	0.98
bottlenose	UTSW	17	46500844	missense	possibly damaging	0.79
flipper	UTSW	17	46525892	missense	probably benign	0.05
orca	UTSW	17	46525135	missense	probably damaging	1.00
FR4340:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4449:Cul9	UTSW	17	46500856	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500846	small insertion	probably benign
FR4737:Cul9	UTSW	17	46500858	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500848	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500850	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500853	small insertion	probably benign
FR4976:Cul9	UTSW	17	46500856	small insertion	probably benign
R0012:Cul9	UTSW	17	46538510	missense	probably benign	0.26
R0079:Cul9	UTSW	17	46537663	nonsense	probably null
R0390:Cul9	UTSW	17	46528589	missense	probably benign	0.34
R0401:Cul9	UTSW	17	46541704	missense	probably damaging	1.00
R0529:Cul9	UTSW	17	46520468	splice site	probably benign
R0815:Cul9	UTSW	17	46537822	splice site	probably null
R0863:Cul9	UTSW	17	46537822	splice site	probably null
R0972:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1173:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1216:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1217:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1261:Cul9	UTSW	17	46525782	missense	probably damaging	1.00
R1278:Cul9	UTSW	17	46500849	small deletion	probably benign
R1281:Cul9	UTSW	17	46511534	missense	probably damaging	1.00
R1349:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1372:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1403:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1405:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1467:Cul9	UTSW	17	46525373	missense	probably damaging	1.00
R1482:Cul9	UTSW	17	46508547	missense	probably damaging	0.99
R1491:Cul9	UTSW	17	46538564	nonsense	probably null
R1618:Cul9	UTSW	17	46525892	missense	probably benign	0.05
R1641:Cul9	UTSW	17	46543560	missense	possibly damaging	0.96
R1679:Cul9	UTSW	17	46521156	missense	possibly damaging	0.90
R1771:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R1803:Cul9	UTSW	17	46503097	missense	probably damaging	1.00
R2020:Cul9	UTSW	17	46522175	missense	probably damaging	1.00
R2046:Cul9	UTSW	17	46543733	missense	probably damaging	1.00
R2056:Cul9	UTSW	17	46543372	missense	probably benign
R2088:Cul9	UTSW	17	46526649	missense	probably damaging	1.00
R2415:Cul9	UTSW	17	46543438	missense	probably benign
R2925:Cul9	UTSW	17	46510981	missense	probably benign	0.08
R2964:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R2965:Cul9	UTSW	17	46502228	missense	probably damaging	0.96
R3690:Cul9	UTSW	17	46504031	splice site	probably null
R3847:Cul9	UTSW	17	46525135	missense	probably damaging	1.00
R4437:Cul9	UTSW	17	46502159	missense	probably damaging	1.00
R4470:Cul9	UTSW	17	46538336	missense	probably benign	0.00
R4540:Cul9	UTSW	17	46503089	missense	probably null	0.98
R4555:Cul9	UTSW	17	46501829	missense	possibly damaging	0.82
R4604:Cul9	UTSW	17	46530146	missense	probably damaging	0.99
R4646:Cul9	UTSW	17	46539017	nonsense	probably null
R4799:Cul9	UTSW	17	46500844	missense	possibly damaging	0.79
R4822:Cul9	UTSW	17	46530051	missense	probably benign	0.01
R4964:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R4965:Cul9	UTSW	17	46538525	missense	probably damaging	1.00
R5027:Cul9	UTSW	17	46500782	missense	probably damaging	0.99
R5185:Cul9	UTSW	17	46525832	missense	possibly damaging	0.95
R5237:Cul9	UTSW	17	46543467	missense	probably benign	0.00
R5278:Cul9	UTSW	17	46510873	missense	probably damaging	1.00
R5361:Cul9	UTSW	17	46500849	small deletion	probably benign
R5455:Cul9	UTSW	17	46510846	splice site	probably null
R5592:Cul9	UTSW	17	46520591	missense	probably benign	0.00
R5597:Cul9	UTSW	17	46502665	missense	possibly damaging	0.56
R5613:Cul9	UTSW	17	46503844	missense	probably damaging	1.00
R6122:Cul9	UTSW	17	46521928	missense	possibly damaging	0.72
R6135:Cul9	UTSW	17	46521453	missense	probably benign
R6352:Cul9	UTSW	17	46511315	missense	probably benign	0.00
R6376:Cul9	UTSW	17	46508563	missense	probably damaging	1.00
R6868:Cul9	UTSW	17	46522183	missense	possibly damaging	0.73
R6898:Cul9	UTSW	17	46511026	missense	possibly damaging	0.87
R7090:Cul9	UTSW	17	46500839	missense	probably damaging	0.96
R7193:Cul9	UTSW	17	46538497	missense	probably damaging	0.98
R7221:Cul9	UTSW	17	46528565	missense	probably damaging	0.99
R7291:Cul9	UTSW	17	46540433	missense	probably benign	0.00
R7320:Cul9	UTSW	17	46510909	missense	possibly damaging	0.80
R7348:Cul9	UTSW	17	46510993	missense	possibly damaging	0.89
R7463:Cul9	UTSW	17	46520476	splice site	probably null
R7480:Cul9	UTSW	17	46537812	missense	probably benign	0.41
R7573:Cul9	UTSW	17	46519910	missense	probably benign
R7582:Cul9	UTSW	17	46510979	missense	probably damaging	1.00
R7605:Cul9	UTSW	17	46541732	missense	probably damaging	0.99
R7684:Cul9	UTSW	17	46509889	missense	probably damaging	1.00
R7830:Cul9	UTSW	17	46540311	missense	probably benign	0.37
R7834:Cul9	UTSW	17	46525704	splice site	probably null
R8131:Cul9	UTSW	17	46511242	missense	probably damaging	1.00
R8192:Cul9	UTSW	17	46538347	missense	probably benign	0.01
R8231:Cul9	UTSW	17	46520501	missense	probably damaging	0.99
R8248:Cul9	UTSW	17	46530014	missense	probably damaging	0.99
R8504:Cul9	UTSW	17	46503580	missense	probably damaging	1.00
R8550:Cul9	UTSW	17	46519846	missense	probably damaging	1.00
RF011:Cul9	UTSW	17	46500848	small insertion	probably benign
RF016:Cul9	UTSW	17	46500863	nonsense	probably null
RF026:Cul9	UTSW	17	46500869	nonsense	probably null
RF027:Cul9	UTSW	17	46500848	small insertion	probably benign
RF030:Cul9	UTSW	17	46500869	small insertion	probably benign
RF033:Cul9	UTSW	17	46500854	small insertion	probably benign
RF039:Cul9	UTSW	17	46500854	small insertion	probably benign
RF041:Cul9	UTSW	17	46500854	nonsense	probably null
RF042:Cul9	UTSW	17	46540615	frame shift	probably null
RF057:Cul9	UTSW	17	46500863	nonsense	probably null
Z1176:Cul9	UTSW	17	46520576	nonsense	probably null
Z1176:Cul9	UTSW	17	46520585	nonsense	probably null
Z1177:Cul9	UTSW	17	46537797	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- AGGCTTCTTCCTGCCAAGATCAAAC -3'
(R):5'- AACAGAACTCTGCTGCTCACGATAC -3'

Sequencing Primer
(F):5'- TGATGTACAAACCCTGGCTCG -3'
(R):5'- CGATACTCAGGTAAAGAGTCTGTCC -3'

Posted On

2013-04-16