Incidental Mutation 'R2037:Ccnt2'
ID224713
Institutional Source Beutler Lab
Gene Symbol Ccnt2
Ensembl Gene ENSMUSG00000026349
Gene Namecyclin T2
Synonyms2900041I18Rik, CycT2
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location127774164-127808061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127803399 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 671 (Y671C)
Ref Sequence ENSEMBL: ENSMUSP00000027587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027587] [ENSMUST00000112570]
Predicted Effect probably damaging
Transcript: ENSMUST00000027587
AA Change: Y671C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027587
Gene: ENSMUSG00000026349
AA Change: Y671C

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 653 N/A INTRINSIC
low complexity region 658 664 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000112570
SMART Domains Protein: ENSMUSP00000108189
Gene: ENSMUSG00000026349

DomainStartEndE-ValueType
CYCLIN 42 141 4.27e-14 SMART
CYCLIN 154 242 4.51e0 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153359
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin and its kinase partner CDK9 were found to be subunits of the transcription elongation factor p-TEFb. The p-TEFb complex containing this cyclin was reported to interact with, and act as a negative regulator of human immunodeficiency virus type 1 (HIV-1) Tat protein. A pseudogene of this gene is found on chromosome 1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to the 4-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Ccnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ccnt2 APN 1 127797891 splice site probably benign
IGL01370:Ccnt2 APN 1 127803513 missense possibly damaging 0.49
IGL02055:Ccnt2 APN 1 127791710 missense possibly damaging 0.46
IGL02169:Ccnt2 APN 1 127774389 splice site probably benign
R0526:Ccnt2 UTSW 1 127799445 missense probably damaging 1.00
R0538:Ccnt2 UTSW 1 127803165 missense probably damaging 0.98
R0744:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0833:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R0836:Ccnt2 UTSW 1 127802394 missense probably benign 0.42
R1763:Ccnt2 UTSW 1 127799406 missense possibly damaging 0.94
R2159:Ccnt2 UTSW 1 127775154 missense probably benign 0.00
R4585:Ccnt2 UTSW 1 127803029 missense probably damaging 0.99
R5342:Ccnt2 UTSW 1 127791733 splice site silent
R5527:Ccnt2 UTSW 1 127802664 missense probably benign 0.00
R5698:Ccnt2 UTSW 1 127803228 missense probably benign 0.00
R6606:Ccnt2 UTSW 1 127803241 missense probably benign 0.00
R6821:Ccnt2 UTSW 1 127803335 missense probably damaging 0.99
R6979:Ccnt2 UTSW 1 127775136 missense probably damaging 0.97
R7512:Ccnt2 UTSW 1 127802294 missense possibly damaging 0.85
X0019:Ccnt2 UTSW 1 127775140 missense probably damaging 1.00
X0027:Ccnt2 UTSW 1 127774288 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCCAGTGCAAGGAAGAAGCTG -3'
(R):5'- GGGCGTTTTCCATTCCAAC -3'

Sequencing Primer
(F):5'- CAGTGCAAGGAAGAAGCTGCATAG -3'
(R):5'- GGCAAGGAAAAGTTGACCTAAAC -3'
Posted On2014-08-25