Incidental Mutation 'R1999:Vmn1r74'
ID224716
Institutional Source Beutler Lab
Gene Symbol Vmn1r74
Ensembl Gene ENSMUSG00000047655
Gene Namevomeronasal 1 receptor 74
SynonymsV1rg5
MMRRC Submission 040009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1999 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location11833980-11853276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 11847375 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 201 (V201F)
Ref Sequence ENSEMBL: ENSMUSP00000154746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050416] [ENSMUST00000228471]
Predicted Effect probably damaging
Transcript: ENSMUST00000050416
AA Change: V201F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055148
Gene: ENSMUSG00000047655
AA Change: V201F

DomainStartEndE-ValueType
Pfam:7tm_1 22 290 1.3e-7 PFAM
Pfam:V1R 34 296 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210930
Predicted Effect probably damaging
Transcript: ENSMUST00000228471
AA Change: V201F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,908,211 T487I probably damaging Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Ambp C T 4: 63,149,429 M181I possibly damaging Het
Anln A G 9: 22,333,052 *1122Q probably null Het
Apc2 C T 10: 80,309,160 T635I probably damaging Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Ceacam5 A T 7: 17,747,247 K306N possibly damaging Het
Cep295nl T C 11: 118,333,089 R310G probably damaging Het
Ces2h A G 8: 105,020,345 T538A probably benign Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Diaph3 T A 14: 86,984,866 D405V possibly damaging Het
Dync1h1 T C 12: 110,666,423 probably null Het
Epha7 C T 4: 28,938,686 Q514* probably null Het
Etfb C T 7: 43,454,563 L141F probably benign Het
Fat1 T C 8: 44,952,393 V727A probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm9268 A T 7: 43,047,459 I647F probably damaging Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Kcnq5 T C 1: 21,402,204 S811G probably null Het
Kcnt1 T A 2: 25,892,360 H156Q probably benign Het
Kif1a T C 1: 93,060,795 N507S probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Medag T A 5: 149,427,252 F64Y probably damaging Het
Mtmr6 T A 14: 60,293,407 S331R probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Nomo1 T C 7: 46,056,727 S502P possibly damaging Het
Olfr1076 T A 2: 86,508,745 Y95* probably null Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Otof T A 5: 30,388,772 E427D probably benign Het
Pclo T C 5: 14,677,080 probably benign Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rad21l T C 2: 151,654,701 probably null Het
Rbbp6 T C 7: 122,990,352 V459A probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Slc44a5 T C 3: 154,258,493 F499L possibly damaging Het
Slitrk3 C T 3: 73,049,964 V492I probably benign Het
Spef2 T A 15: 9,668,903 probably null Het
Ssc5d A T 7: 4,942,714 D915V possibly damaging Het
Stard9 A G 2: 120,692,868 D668G probably damaging Het
Sycp2l A G 13: 41,118,304 D73G probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem8b G A 4: 43,681,300 C439Y probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Other mutations in Vmn1r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Vmn1r74 APN 7 11847633 missense probably damaging 0.98
IGL01673:Vmn1r74 APN 7 11847390 missense possibly damaging 0.94
IGL03023:Vmn1r74 APN 7 11847330 missense possibly damaging 0.46
IGL03409:Vmn1r74 APN 7 11847313 missense probably damaging 0.99
R0393:Vmn1r74 UTSW 7 11847315 missense possibly damaging 0.79
R1488:Vmn1r74 UTSW 7 11847583 missense probably benign 0.02
R1707:Vmn1r74 UTSW 7 11847577 missense probably damaging 0.98
R1998:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R2139:Vmn1r74 UTSW 7 11847316 missense probably damaging 1.00
R4027:Vmn1r74 UTSW 7 11846971 missense probably damaging 0.98
R4576:Vmn1r74 UTSW 7 11846769 unclassified probably null
R4619:Vmn1r74 UTSW 7 11847471 missense possibly damaging 0.61
R4619:Vmn1r74 UTSW 7 11847476 missense probably damaging 1.00
R5371:Vmn1r74 UTSW 7 11847057 missense probably damaging 1.00
R5606:Vmn1r74 UTSW 7 11846895 missense probably benign 0.01
R6464:Vmn1r74 UTSW 7 11847204 missense possibly damaging 0.87
R6901:Vmn1r74 UTSW 7 11847441 missense probably benign 0.00
R6920:Vmn1r74 UTSW 7 11847648 missense probably benign 0.01
R7223:Vmn1r74 UTSW 7 11846967 nonsense probably null
R7231:Vmn1r74 UTSW 7 11846961 missense probably benign 0.34
R7418:Vmn1r74 UTSW 7 11847154 missense possibly damaging 0.88
R8135:Vmn1r74 UTSW 7 11847603 missense probably benign 0.36
RF049:Vmn1r74 UTSW 7 11847140 frame shift probably null
RF063:Vmn1r74 UTSW 7 11847140 frame shift probably null
Z1176:Vmn1r74 UTSW 7 11847009 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACTTTGCTGGCTTGTACAAC -3'
(R):5'- CACCCATAGCATTGGATATTTGGAG -3'

Sequencing Primer
(F):5'- CTATTTCTAAACATATTGGCTGCAGC -3'
(R):5'- AGCATTGGATATTTGGAGTAGGTTG -3'
Posted On2014-08-25