Incidental Mutation 'R2037:Enah'
ID224721
Institutional Source Beutler Lab
Gene Symbol Enah
Ensembl Gene ENSMUSG00000022995
Gene NameENAH actin regulator
SynonymsNdpp1, Mena
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181896384-182019990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181921972 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 415 (P415L)
Ref Sequence ENSEMBL: ENSMUSP00000141344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078719] [ENSMUST00000111024] [ENSMUST00000111025] [ENSMUST00000111030] [ENSMUST00000177811] [ENSMUST00000192967] [ENSMUST00000193074] [ENSMUST00000193703] [ENSMUST00000195059]
Predicted Effect probably damaging
Transcript: ENSMUST00000078719
AA Change: P434L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077781
Gene: ENSMUSG00000022995
AA Change: P434L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 154 258 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
low complexity region 308 317 N/A INTRINSIC
internal_repeat_1 354 366 4.73e-6 PROSPERO
low complexity region 373 392 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
low complexity region 430 471 N/A INTRINSIC
low complexity region 487 507 N/A INTRINSIC
low complexity region 542 609 N/A INTRINSIC
low complexity region 665 678 N/A INTRINSIC
internal_repeat_1 746 758 4.73e-6 PROSPERO
Pfam:VASP_tetra 765 801 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111024
SMART Domains Protein: ENSMUSP00000106653
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111025
SMART Domains Protein: ENSMUSP00000106654
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 313 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
Pfam:VASP_tetra 467 506 2.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111030
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106659
Gene: ENSMUSG00000022995
AA Change: P419L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 3.87e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 3.87e-6 PROSPERO
Pfam:VASP_tetra 749 788 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177811
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136863
Gene: ENSMUSG00000022995
AA Change: P419L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 4.25e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 4.25e-6 PROSPERO
Pfam:VASP_tetra 749 788 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192967
SMART Domains Protein: ENSMUSP00000141330
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 63 1e-3 SMART
low complexity region 70 99 N/A INTRINSIC
low complexity region 118 138 N/A INTRINSIC
low complexity region 173 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193074
SMART Domains Protein: ENSMUSP00000141936
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 7 127 1.5e-4 SMART
WH1 21 128 2.8e-47 SMART
coiled coil region 155 260 N/A INTRINSIC
low complexity region 262 329 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
Pfam:VASP_tetra 484 523 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193703
SMART Domains Protein: ENSMUSP00000141462
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 346 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Pfam:VASP_tetra 501 540 2.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195059
AA Change: P415L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141344
Gene: ENSMUSG00000022995
AA Change: P415L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted mutation show defects in major axonal projection pathways in brain, including malformation of the hippocampal commissure and pontocerebellar fibers and frequent agenesis of the corpus callosum due to a failure of axons to project across the midline during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Enah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Enah APN 1 181935696 intron probably benign
IGL01996:Enah APN 1 181956505 missense unknown
R0025:Enah UTSW 1 181913373 missense possibly damaging 0.53
R0612:Enah UTSW 1 181906448 splice site probably benign
R1005:Enah UTSW 1 181961930 splice site probably benign
R1075:Enah UTSW 1 181956501 missense unknown
R1589:Enah UTSW 1 181922293 missense probably damaging 1.00
R1601:Enah UTSW 1 181919620 nonsense probably null
R1607:Enah UTSW 1 181917197 critical splice donor site probably null
R1785:Enah UTSW 1 181956429 missense unknown
R2035:Enah UTSW 1 181921972 missense probably damaging 1.00
R2119:Enah UTSW 1 181921753 missense probably damaging 0.98
R2180:Enah UTSW 1 181918459 missense probably damaging 1.00
R2233:Enah UTSW 1 181921972 missense probably damaging 1.00
R4348:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4350:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4576:Enah UTSW 1 181919563 missense possibly damaging 0.79
R4956:Enah UTSW 1 181918289 missense probably damaging 0.98
R5230:Enah UTSW 1 181935670 intron probably benign
R5282:Enah UTSW 1 181935728 splice site probably null
R5505:Enah UTSW 1 181906453 splice site probably benign
R5813:Enah UTSW 1 181931185 intron probably benign
R6324:Enah UTSW 1 181918571 missense probably damaging 1.00
R6374:Enah UTSW 1 181923580 missense unknown
R6503:Enah UTSW 1 181918511 missense probably damaging 1.00
R6513:Enah UTSW 1 182014355 intron probably benign
R6925:Enah UTSW 1 181905898 critical splice acceptor site probably null
R6925:Enah UTSW 1 181905899 critical splice acceptor site probably null
R7184:Enah UTSW 1 181922392 missense probably damaging 0.99
R7308:Enah UTSW 1 181906385 critical splice donor site probably null
R7453:Enah UTSW 1 181961905 missense unknown
R7759:Enah UTSW 1 181918444 missense unknown
RF024:Enah UTSW 1 181921934 frame shift probably null
RF032:Enah UTSW 1 181921929 frame shift probably null
RF038:Enah UTSW 1 181921935 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAGAACACTGGGCTTGGATG -3'
(R):5'- GTGAACACACCCTCTTCTCAG -3'

Sequencing Primer
(F):5'- CACTGGGCTTGGATGAGGGAG -3'
(R):5'- AAGTCCTGTGCCTGGCCTAC -3'
Posted On2014-08-25