Incidental Mutation 'R2037:Nmt2'
ID224723
Institutional Source Beutler Lab
Gene Symbol Nmt2
Ensembl Gene ENSMUSG00000026643
Gene NameN-myristoyltransferase 2
SynonymshNMT-2, A930001K02Rik
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3284212-3328877 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3309581 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 121 (F121L)
Ref Sequence ENSEMBL: ENSMUSP00000100054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081932] [ENSMUST00000091504] [ENSMUST00000102989]
Predicted Effect probably damaging
Transcript: ENSMUST00000081932
AA Change: F152L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080600
Gene: ENSMUSG00000026643
AA Change: F152L

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 170 327 1e-78 PFAM
Pfam:NMT_C 341 528 2.9e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091504
AA Change: F108L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089085
Gene: ENSMUSG00000026643
AA Change: F108L

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:NMT 124 283 2e-84 PFAM
Pfam:NMT_C 297 484 1.4e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102989
AA Change: F121L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100054
Gene: ENSMUSG00000026643
AA Change: F121L

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 137 296 7.8e-85 PFAM
Pfam:NMT_C 310 497 6.4e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155761
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two N-myristoyltransferase proteins. N-terminal myristoylation is a lipid modification that is involved in regulating the function and localization of signaling proteins. The encoded protein catalyzes the addition of a myristoyl group to the N-terminal glycine residue of many signaling proteins, including the human immunodeficiency virus type 1 (HIV-1) proteins, Gag and Nef. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Nmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL00784:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL01871:Nmt2 APN 2 3312674 missense probably damaging 1.00
IGL02617:Nmt2 APN 2 3314713 missense probably benign 0.15
Faul UTSW 2 3305304 intron probably null
ANU05:Nmt2 UTSW 2 3314694 missense probably benign
R0278:Nmt2 UTSW 2 3325387 missense probably benign 0.00
R0524:Nmt2 UTSW 2 3305437 missense probably benign
R0743:Nmt2 UTSW 2 3314785 nonsense probably null
R0884:Nmt2 UTSW 2 3314785 nonsense probably null
R1895:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1946:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1957:Nmt2 UTSW 2 3325382 missense possibly damaging 0.95
R2656:Nmt2 UTSW 2 3307013 missense probably benign
R3422:Nmt2 UTSW 2 3284388 missense possibly damaging 0.82
R3835:Nmt2 UTSW 2 3314686 splice site probably benign
R3955:Nmt2 UTSW 2 3312498 missense probably benign 0.00
R4701:Nmt2 UTSW 2 3322641 missense probably benign
R5032:Nmt2 UTSW 2 3284392 missense probably benign
R6373:Nmt2 UTSW 2 3324951 missense probably benign 0.05
R6396:Nmt2 UTSW 2 3314701 missense probably benign 0.18
R6410:Nmt2 UTSW 2 3316178 missense probably damaging 1.00
R6863:Nmt2 UTSW 2 3305304 intron probably null
R6865:Nmt2 UTSW 2 3314729 missense probably damaging 1.00
R7100:Nmt2 UTSW 2 3312913 missense probably benign
R7139:Nmt2 UTSW 2 3284315 missense probably benign 0.01
R7516:Nmt2 UTSW 2 3312730 missense probably damaging 1.00
X0067:Nmt2 UTSW 2 3324961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTAGCAGGCTTCCAGGAGG -3'
(R):5'- GCAATTAGGCTACAATCAACGATAC -3'

Sequencing Primer
(F):5'- CAGTTGCCCTGTGTTCAAAGGC -3'
(R):5'- GGCTACAATCAACGATACTGAAAAC -3'
Posted On2014-08-25