Incidental Mutation 'R2037:Olfr1054'
ID224731
Institutional Source Beutler Lab
Gene Symbol Olfr1054
Ensembl Gene ENSMUSG00000075190
Gene Nameolfactory receptor 1054
SynonymsGA_x6K02T2Q125-47811880-47810942, MOR188-2
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86332135-86335433 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86332430 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 309 (N309D)
Ref Sequence ENSEMBL: ENSMUSP00000150810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099895] [ENSMUST00000213205]
Predicted Effect probably benign
Transcript: ENSMUST00000099895
AA Change: N309D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097480
Gene: ENSMUSG00000075190
AA Change: N309D

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-49 PFAM
Pfam:7tm_1 41 289 5.5e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122018
Predicted Effect probably benign
Transcript: ENSMUST00000213205
AA Change: N309D

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Olfr1054
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Olfr1054 APN 2 86332704 nonsense probably null
IGL02266:Olfr1054 APN 2 86332979 missense probably damaging 0.98
IGL02398:Olfr1054 APN 2 86332524 nonsense probably null
IGL02535:Olfr1054 APN 2 86332675 missense probably damaging 1.00
IGL02590:Olfr1054 APN 2 86333000 missense possibly damaging 0.52
IGL02630:Olfr1054 APN 2 86332868 missense probably benign 0.39
PIT4151001:Olfr1054 UTSW 2 86332829 missense possibly damaging 0.60
R0520:Olfr1054 UTSW 2 86333131 missense probably damaging 1.00
R1079:Olfr1054 UTSW 2 86332841 missense probably damaging 0.96
R1887:Olfr1054 UTSW 2 86333273 missense possibly damaging 0.90
R2120:Olfr1054 UTSW 2 86333345 missense probably benign 0.00
R2153:Olfr1054 UTSW 2 86332528 missense probably damaging 1.00
R4523:Olfr1054 UTSW 2 86333300 missense probably benign 0.12
R4836:Olfr1054 UTSW 2 86333227 missense probably benign 0.12
R6147:Olfr1054 UTSW 2 86332500 missense probably damaging 1.00
R6802:Olfr1054 UTSW 2 86333185 missense possibly damaging 0.91
R6886:Olfr1054 UTSW 2 86333064 nonsense probably null
R6894:Olfr1054 UTSW 2 86332951 missense probably damaging 1.00
R7275:Olfr1054 UTSW 2 86332792 missense possibly damaging 0.91
R7322:Olfr1054 UTSW 2 86332564 missense probably benign 0.14
R7325:Olfr1054 UTSW 2 86333000 missense possibly damaging 0.52
R7526:Olfr1054 UTSW 2 86333353 start codon destroyed probably null 1.00
R7976:Olfr1054 UTSW 2 86332720 missense probably benign 0.05
R8421:Olfr1054 UTSW 2 86332903 missense possibly damaging 0.80
R8838:Olfr1054 UTSW 2 86332973 missense possibly damaging 0.61
Z1176:Olfr1054 UTSW 2 86332706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCCACAGTTTGTATGTGC -3'
(R):5'- GGCAGGCAGAAAGCTTTGTC -3'

Sequencing Primer
(F):5'- ACTTGGTCATTCCTTTATCAAACATG -3'
(R):5'- CAGGCAGAAAGCTTTGTCTACTTG -3'
Posted On2014-08-25