Incidental Mutation 'R2037:Ppip5k1'
ID224733
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Namediphosphoinositol pentakisphosphate kinase 1
SynonymsHisppd2a, B430315C20Rik
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121310561-121355396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121343193 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 399 (R399H)
Ref Sequence ENSEMBL: ENSMUSP00000106258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628]
Predicted Effect probably damaging
Transcript: ENSMUST00000052029
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110625
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110626
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110627
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110628
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134644
Predicted Effect probably benign
Transcript: ENSMUST00000137087
SMART Domains Protein: ENSMUSP00000115051
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
PDB:4NZO|A 2 67 3e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150081
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121347358 missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121343179 missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121343210 nonsense probably null
IGL01704:Ppip5k1 APN 2 121312074 missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121337860 missense probably benign
IGL02101:Ppip5k1 APN 2 121331608 missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121331553 splice site probably null
IGL02701:Ppip5k1 APN 2 121316649 splice site probably null
IGL03188:Ppip5k1 APN 2 121326846 unclassified probably benign
R0363:Ppip5k1 UTSW 2 121347355 missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121312005 missense probably benign 0.13
R1664:Ppip5k1 UTSW 2 121337182 missense probably benign 0.02
R1753:Ppip5k1 UTSW 2 121342631 missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121350586 missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121348547 missense probably damaging 1.00
R2033:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121342871 unclassified probably benign
R2103:Ppip5k1 UTSW 2 121321653 unclassified probably null
R3414:Ppip5k1 UTSW 2 121327661 missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121343563 missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R4843:Ppip5k1 UTSW 2 121326887 missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121312390 missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121311720 missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121336772 missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121316676 missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121337899 missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121350491 nonsense probably null
R6076:Ppip5k1 UTSW 2 121337110 missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121337463 missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121323203 unclassified probably benign
R6555:Ppip5k1 UTSW 2 121337612 missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121311936 missense probably benign 0.00
R7075:Ppip5k1 UTSW 2 121321750 missense probably damaging 1.00
R7251:Ppip5k1 UTSW 2 121347571 missense probably benign 0.05
R7332:Ppip5k1 UTSW 2 121311969 missense probably damaging 0.96
R7359:Ppip5k1 UTSW 2 121340848 missense possibly damaging 0.95
R7462:Ppip5k1 UTSW 2 121336751 missense probably damaging 0.98
R7568:Ppip5k1 UTSW 2 121337615 missense probably damaging 1.00
R7654:Ppip5k1 UTSW 2 121348559 missense probably damaging 1.00
R7678:Ppip5k1 UTSW 2 121337661 missense probably damaging 1.00
X0020:Ppip5k1 UTSW 2 121341655 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTAGACTAGGGCTCCTGACCAG -3'
(R):5'- CAAGGTGCTTTAACTCCATCAC -3'

Sequencing Primer
(F):5'- TAGGGCTCCTGACCAGACCTC -3'
(R):5'- ATCACTGTGTCTGGCCTCAGG -3'
Posted On2014-08-25