Mutagenetix > Incidental Mutations

Incidental Mutation 'R2037:Kiz'

224735

Institutional Source

Beutler Lab

Gene Symbol

Kiz

Ensembl Gene

ENSMUSG00000074749

Gene Name

kizuna centrosomal protein

Synonyms

Plk1s1, LOC228730, Ncrna00153, Gm114

MMRRC Submission

040044-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2037 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146855864-146970097 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 146969960 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 663 (F663S)

Ref Sequence

ENSEMBL: ENSMUSP00000096884 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099278]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099278
AA Change: F663S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096884
Gene: ENSMUSG00000074749
AA Change: F663S

Domain	Start	End	E-Value	Type
low complexity region	3	11	N/A	INTRINSIC
low complexity region	15	26	N/A	INTRINSIC
low complexity region	60	75	N/A	INTRINSIC
coiled coil region	102	132	N/A	INTRINSIC
low complexity region	302	313	N/A	INTRINSIC
low complexity region	376	399	N/A	INTRINSIC
low complexity region	632	646	N/A	INTRINSIC
low complexity region	679	694	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135595

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to centrosomes, strengthening and stabilizing the pericentriolar region prior to spindle formation. The encoded protein usually remains with the mother centrosome after centrosomal duplication. Sevral transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutants with truncated C-term transcript were normal size and weight, bred normally with normal litter size, and no obvious defects during fetal or adult development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,089,984		probably null	Het
AI987944	T	C	7: 41,374,391	Y391C	probably benign	Het
Ankfn1	A	T	11: 89,456,120	S296T	probably benign	Het
Apob	A	G	12: 8,007,488	D1957G	probably benign	Het
Baz1a	G	T	12: 54,929,646	P415Q	probably damaging	Het
Brca2	T	A	5: 150,540,669	H1299Q	probably benign	Het
C7	G	T	15: 5,034,238	S227*	probably null	Het
Catsperb	A	T	12: 101,507,962	R306S	probably damaging	Het
Cbx3	T	A	6: 51,471,813		probably null	Het
Ccdc129	A	G	6: 55,897,875	N270S	probably benign	Het
Ccnt2	A	G	1: 127,803,399	Y671C	probably damaging	Het
Crocc	A	G	4: 141,046,942		probably null	Het
Ctr9	G	A	7: 111,046,807	V669I	probably benign	Het
Dck	T	G	5: 88,772,717	Y99D	probably damaging	Het
Ddx52	T	A	11: 83,944,606	D119E	probably benign	Het
Dnah10	A	T	5: 124,746,704	K596N	probably benign	Het
Dnah7a	A	T	1: 53,582,582	V1128E	probably benign	Het
Dph1	A	T	11: 75,185,853		probably null	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Enthd1	A	G	15: 80,560,349	S2P	possibly damaging	Het
Erc1	A	C	6: 119,722,255	V802G	possibly damaging	Het
F8	ATCTCTCTC	ATCTCTC	X: 75,322,998		probably null	Het
Fam169a	C	A	13: 97,107,092	A210E	probably benign	Het
Fcmr	A	G	1: 130,878,333	D342G	possibly damaging	Het
Fgfr4	T	G	13: 55,167,889	V743G	possibly damaging	Het
Fsip2	A	G	2: 82,978,512	D1725G	probably damaging	Het
Heatr5b	A	T	17: 78,829,505	C195*	probably null	Het
Herc2	G	A	7: 56,205,961	A3882T	probably damaging	Het
Il20	T	A	1: 130,908,378	N143Y	probably damaging	Het
Inpp5b	A	G	4: 124,798,299	S892G	probably damaging	Het
Ipo13	A	T	4: 117,904,661	Y447*	probably null	Het
Kbtbd12	A	T	6: 88,617,797	N350K	probably benign	Het
Matn2	A	G	15: 34,433,117	D870G	probably benign	Het
Methig1	C	T	15: 100,353,586	A126V	probably benign	Het
Mme	A	G	3: 63,328,260	D209G	probably null	Het
Mroh4	A	G	15: 74,609,761	F811L	possibly damaging	Het
Myo9b	G	T	8: 71,290,866	K190N	probably damaging	Het
Ncf1	T	C	5: 134,229,552	I6V	probably damaging	Het
Nmt2	T	C	2: 3,309,581	F121L	probably damaging	Het
Nol10	A	G	12: 17,361,151	D183G	probably benign	Het
Nsun7	T	C	5: 66,261,086	V53A	probably benign	Het
Olfr1045	T	C	2: 86,197,832	S307G	probably benign	Het
Olfr1054	T	C	2: 86,332,430	N309D	probably benign	Het
Olfr819	T	C	10: 129,966,140	I187V	probably benign	Het
Pappa2	A	T	1: 158,956,644	Y265*	probably null	Het
Pigg	G	A	5: 108,338,652	A724T	probably damaging	Het
Pik3r4	C	T	9: 105,650,335	R296C	probably benign	Het
Pkhd1l1	A	G	15: 44,568,221		probably null	Het
Pld4	A	G	12: 112,768,558	D483G	probably damaging	Het
Ppip5k1	C	T	2: 121,343,193	R399H	probably damaging	Het
Qrfpr	A	T	3: 36,182,657	H198Q	probably damaging	Het
Rasgrf2	A	T	13: 91,902,629	D883E	probably damaging	Het
Retnlg	T	C	16: 48,874,252	C88R	probably damaging	Het
Sin3a	C	T	9: 57,096,825	T287I	probably benign	Het
Slc44a1	GCC	GCCCCC	4: 53,563,243		probably benign	Het
Sppl2c	G	C	11: 104,186,481	V36L	probably benign	Het
Srp72	T	A	5: 76,976,491	I68N	probably damaging	Het
Srrm3	T	A	5: 135,854,377	S195R	probably damaging	Het
Srrm4	T	A	5: 116,467,828		probably benign	Het
Ssb	A	G	2: 69,868,819	S199G	probably benign	Het
Sult2a6	T	A	7: 14,254,709	Y42F	probably damaging	Het
Syne2	A	G	12: 76,025,569	T120A	probably benign	Het
Tas1r1	A	G	4: 152,028,170	F809L	probably damaging	Het
Tead3	A	G	17: 28,336,570	S117P	probably damaging	Het
Tefm	C	T	11: 80,140,230	R60H	probably damaging	Het
Tmem104	G	A	11: 115,201,395	R110H	possibly damaging	Het
Tnxb	G	A	17: 34,699,205	G2364D	probably damaging	Het
Vmn1r211	T	A	13: 22,851,964	I178F	probably damaging	Het
Vmn1r6	A	T	6: 57,003,124	Y235F	probably damaging	Het
Xrcc5	C	A	1: 72,346,370	T540K	probably benign	Het

Other mutations in Kiz

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01448:Kiz	APN	2	146863801	missense	probably benign	0.22
IGL01649:Kiz	APN	2	146889309	missense	probably benign	0.35
IGL02184:Kiz	APN	2	146889600	missense	probably benign	0.20
IGL02500:Kiz	APN	2	146863813	missense	probably benign	0.06
IGL02548:Kiz	APN	2	146870770	missense	probably damaging	0.99
R0284:Kiz	UTSW	2	146863810	missense	probably benign	0.22
R0364:Kiz	UTSW	2	146942156	missense	probably benign	0.20
R0478:Kiz	UTSW	2	146942158	missense	possibly damaging	0.93
R0685:Kiz	UTSW	2	146856058	splice site	probably benign
R0767:Kiz	UTSW	2	146889051	missense	probably damaging	1.00
R0866:Kiz	UTSW	2	146856053	splice site	probably benign
R1180:Kiz	UTSW	2	146970007	missense	unknown
R2055:Kiz	UTSW	2	146891283	missense	probably benign	0.10
R2877:Kiz	UTSW	2	146889556	missense	possibly damaging	0.75
R4780:Kiz	UTSW	2	146889246	missense	possibly damaging	0.90
R4822:Kiz	UTSW	2	146891069	missense	probably damaging	1.00
R4835:Kiz	UTSW	2	146942088	missense	probably damaging	1.00
R5004:Kiz	UTSW	2	146969979	missense	possibly damaging	0.83
R5473:Kiz	UTSW	2	146969995	nonsense	probably null
R5878:Kiz	UTSW	2	146889601	missense	probably damaging	0.99
R6216:Kiz	UTSW	2	146889497	missense	probably damaging	1.00
R6222:Kiz	UTSW	2	146891061	missense	probably damaging	1.00
R7144:Kiz	UTSW	2	146950510	splice site	probably null
R7475:Kiz	UTSW	2	146891086	missense	possibly damaging	0.90
R7580:Kiz	UTSW	2	146956249	missense	probably damaging	0.99
R7848:Kiz	UTSW	2	146889180	missense	probably benign	0.19
R7931:Kiz	UTSW	2	146889180	missense	probably benign	0.19
RF021:Kiz	UTSW	2	146870830	missense	possibly damaging	0.74
Z1177:Kiz	UTSW	2	146935827	missense	not run

Predicted Primers

PCR Primer
(F):5'- ACTCTGCCTACTGAACACTGTG -3'
(R):5'- CATGCTAGGCAAGTGTTGTAGTC -3'

Sequencing Primer
(F):5'- CTGAACACTGTGAAGAATATAGCATG -3'
(R):5'- TCCCCTTTGACAACTAGCAAACTTAG -3'

Posted On

2014-08-25