Incidental Mutation 'R2037:Qrfpr'
List |< first << previous [record 52 of 71] next >> last >|
ID224737
Institutional Source Beutler Lab
Gene Symbol Qrfpr
Ensembl Gene ENSMUSG00000058400
Gene Namepyroglutamylated RFamide peptide receptor
SynonymsGpr103, AQ27
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36179424-36222313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36182657 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 198 (H198Q)
Ref Sequence ENSEMBL: ENSMUSP00000088768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091227] [ENSMUST00000197447]
Predicted Effect probably damaging
Transcript: ENSMUST00000091227
AA Change: H198Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088768
Gene: ENSMUSG00000058400
AA Change: H198Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 56 347 3.6e-8 PFAM
Pfam:7tm_1 62 332 4.5e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197447
AA Change: H198Q

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143773
Gene: ENSMUSG00000058400
AA Change: H198Q

DomainStartEndE-ValueType
low complexity region 40 61 N/A INTRINSIC
Pfam:7tm_1 62 229 1.1e-35 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation diisplay kyphosis with abnormal vertebrae morphology and development including osteopenia of the vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Qrfpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Qrfpr APN 3 36181051 splice site probably null
IGL02274:Qrfpr APN 3 36222136 missense probably damaging 0.98
R0382:Qrfpr UTSW 3 36180969 missense possibly damaging 0.73
R0398:Qrfpr UTSW 3 36181052 splice site probably benign
R0631:Qrfpr UTSW 3 36221989 missense probably damaging 1.00
R0690:Qrfpr UTSW 3 36189559 missense probably damaging 1.00
R1222:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1413:Qrfpr UTSW 3 36182660 missense possibly damaging 0.92
R1418:Qrfpr UTSW 3 36180095 missense probably damaging 1.00
R1500:Qrfpr UTSW 3 36182580 missense probably damaging 1.00
R3924:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3925:Qrfpr UTSW 3 36221923 missense possibly damaging 0.71
R3966:Qrfpr UTSW 3 36181000 missense possibly damaging 0.73
R4298:Qrfpr UTSW 3 36189554 missense probably damaging 1.00
R4751:Qrfpr UTSW 3 36182622 missense possibly damaging 0.67
R4760:Qrfpr UTSW 3 36221924 missense probably benign 0.34
R4989:Qrfpr UTSW 3 36222136 missense probably damaging 0.98
R5548:Qrfpr UTSW 3 36221926 missense possibly damaging 0.84
R5607:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R5608:Qrfpr UTSW 3 36180965 missense possibly damaging 0.55
R6027:Qrfpr UTSW 3 36222038 missense probably benign 0.44
R6115:Qrfpr UTSW 3 36182593 missense possibly damaging 0.51
R6546:Qrfpr UTSW 3 36180265 missense probably damaging 1.00
R6714:Qrfpr UTSW 3 36180256 missense possibly damaging 0.81
R7080:Qrfpr UTSW 3 36180049 missense probably benign 0.04
R7833:Qrfpr UTSW 3 36189602 missense probably benign
R7916:Qrfpr UTSW 3 36189602 missense probably benign
Z1176:Qrfpr UTSW 3 36182610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAGACCTGGCTATTTTGG -3'
(R):5'- AAAGCTGCACTTTACTGCAAC -3'

Sequencing Primer
(F):5'- ACAGACCTGGCTATTTTGGACATTTC -3'
(R):5'- GCTGCACTTTACTGCAACATAGC -3'
Posted On2014-08-25