Incidental Mutation 'R2037:Slc44a1'
ID224741
Institutional Source Beutler Lab
Gene Symbol Slc44a1
Ensembl Gene ENSMUSG00000028412
Gene Namesolute carrier family 44, member 1
SynonymsCdw92, 4833416H08Rik, CHTL1, CTL1, 2210409B22Rik
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2037 (G1)
Quality Score126
Status Not validated
Chromosome4
Chromosomal Location53440413-53622478 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GCC to GCCCCC at 53563243 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102911] [ENSMUST00000107645] [ENSMUST00000107647] [ENSMUST00000107651]
Predicted Effect probably benign
Transcript: ENSMUST00000102911
SMART Domains Protein: ENSMUSP00000099975
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 2.4e-107 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107645
SMART Domains Protein: ENSMUSP00000103272
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
Pfam:Choline_transpo 83 403 4.8e-108 PFAM
low complexity region 423 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107647
SMART Domains Protein: ENSMUSP00000103274
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 292 607 1.8e-105 PFAM
low complexity region 630 643 N/A INTRINSIC
transmembrane domain 682 704 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107651
SMART Domains Protein: ENSMUSP00000103278
Gene: ENSMUSG00000028412

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
Pfam:Choline_transpo 290 610 3.5e-108 PFAM
low complexity region 630 643 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138377
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Slc44a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc44a1 APN 4 53543571 missense probably damaging 1.00
IGL00420:Slc44a1 APN 4 53553550 missense possibly damaging 0.86
IGL01369:Slc44a1 APN 4 53491448 missense probably damaging 1.00
IGL01867:Slc44a1 APN 4 53536405 missense probably damaging 1.00
IGL02188:Slc44a1 APN 4 53541361 missense probably benign 0.01
IGL03095:Slc44a1 APN 4 53536374 nonsense probably null
R0517:Slc44a1 UTSW 4 53542366 missense probably damaging 0.99
R0815:Slc44a1 UTSW 4 53536421 missense possibly damaging 0.77
R1437:Slc44a1 UTSW 4 53561006 missense probably damaging 1.00
R1443:Slc44a1 UTSW 4 53561069 missense probably damaging 1.00
R1673:Slc44a1 UTSW 4 53542468 missense probably benign 0.04
R2131:Slc44a1 UTSW 4 53563246 frame shift probably null
R3417:Slc44a1 UTSW 4 53553549 missense probably benign 0.04
R3721:Slc44a1 UTSW 4 53491445 missense probably damaging 1.00
R3763:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4426:Slc44a1 UTSW 4 53563286 missense probably benign 0.45
R4751:Slc44a1 UTSW 4 53560973 missense probably damaging 1.00
R4993:Slc44a1 UTSW 4 53543644 missense probably damaging 1.00
R5853:Slc44a1 UTSW 4 53528682 missense probably benign 0.00
R6293:Slc44a1 UTSW 4 53561099 missense probably damaging 1.00
R6978:Slc44a1 UTSW 4 53544671 missense probably damaging 1.00
R7164:Slc44a1 UTSW 4 53528711 missense probably benign 0.09
R7838:Slc44a1 UTSW 4 53517657 missense probably benign 0.01
R7921:Slc44a1 UTSW 4 53517657 missense probably benign 0.01
Z1176:Slc44a1 UTSW 4 53553504 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTGGATCCTTAAAGTTCACCTAC -3'
(R):5'- AACCAGCTTTGACTCGGAGG -3'

Sequencing Primer
(F):5'- GATCCTTAAAGTTCACCTACTGACTG -3'
(R):5'- CAGCTCACTTTCACAGATGGTAG -3'
Posted On2014-08-25