Incidental Mutation 'R2037:Tas1r1'
ID224749
Institutional Source Beutler Lab
Gene Symbol Tas1r1
Ensembl Gene ENSMUSG00000028950
Gene Nametaste receptor, type 1, member 1
SynonymsTR1, T1r1, Gpr70, T1R1
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152027914-152038568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152028170 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 809 (F809L)
Ref Sequence ENSEMBL: ENSMUSP00000030792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389] [ENSMUST00000156748]
Predicted Effect probably damaging
Transcript: ENSMUST00000030792
AA Change: F809L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: F809L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066715
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Tas1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Tas1r1 APN 4 152028340 missense possibly damaging 0.82
IGL02867:Tas1r1 APN 4 152028278 missense probably damaging 1.00
R1547:Tas1r1 UTSW 4 152028419 missense probably damaging 1.00
R1775:Tas1r1 UTSW 4 152038218 nonsense probably null
R1803:Tas1r1 UTSW 4 152032248 missense probably damaging 0.99
R2083:Tas1r1 UTSW 4 152028391 missense probably benign 0.02
R3821:Tas1r1 UTSW 4 152034681 missense probably benign
R3912:Tas1r1 UTSW 4 152031924 missense probably damaging 0.97
R4227:Tas1r1 UTSW 4 152028272 missense probably damaging 0.99
R4272:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4273:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4818:Tas1r1 UTSW 4 152032674 missense probably benign 0.15
R5567:Tas1r1 UTSW 4 152038325 missense probably damaging 0.99
R6183:Tas1r1 UTSW 4 152032541 missense probably damaging 1.00
R7162:Tas1r1 UTSW 4 152032238 missense possibly damaging 0.91
R7427:Tas1r1 UTSW 4 152038308 missense probably benign 0.39
R7535:Tas1r1 UTSW 4 152028362 missense probably benign 0.06
R7736:Tas1r1 UTSW 4 152032466 missense probably benign 0.17
R7796:Tas1r1 UTSW 4 152034755 missense probably benign 0.01
Z1177:Tas1r1 UTSW 4 152032214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTATACATCGCAAGCCGTG -3'
(R):5'- TCTGCAGCTACCTGGGTAAG -3'

Sequencing Primer
(F):5'- GCTGAGCTCTCCCAGACAC -3'
(R):5'- CTGGGTAAGGAACTGCCG -3'
Posted On2014-08-25