Incidental Mutation 'R2037:Pigg'
ID224759
Institutional Source Beutler Lab
Gene Symbol Pigg
Ensembl Gene ENSMUSG00000029263
Gene Namephosphatidylinositol glycan anchor biosynthesis, class G
SynonymsGpi7
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108312609-108349355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108338652 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 724 (A724T)
Ref Sequence ENSEMBL: ENSMUSP00000113818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031189] [ENSMUST00000118910] [ENSMUST00000119014]
Predicted Effect probably damaging
Transcript: ENSMUST00000031189
AA Change: A716T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031189
Gene: ENSMUSG00000029263
AA Change: A716T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 68 314 6.3e-15 PFAM
transmembrane domain 428 450 N/A INTRINSIC
transmembrane domain 463 482 N/A INTRINSIC
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 540 562 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
transmembrane domain 688 705 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
transmembrane domain 785 802 N/A INTRINSIC
transmembrane domain 876 898 N/A INTRINSIC
transmembrane domain 911 933 N/A INTRINSIC
transmembrane domain 948 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118910
AA Change: A591T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112984
Gene: ENSMUSG00000029263
AA Change: A591T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
SCOP:d1eqja2 127 202 8e-8 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 338 357 N/A INTRINSIC
transmembrane domain 372 394 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
transmembrane domain 563 580 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 624 641 N/A INTRINSIC
transmembrane domain 660 677 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 786 808 N/A INTRINSIC
transmembrane domain 823 842 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119014
AA Change: A724T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113818
Gene: ENSMUSG00000029263
AA Change: A724T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 164 286 2.2e-9 PFAM
transmembrane domain 436 458 N/A INTRINSIC
transmembrane domain 471 490 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 548 570 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
transmembrane domain 696 713 N/A INTRINSIC
transmembrane domain 720 742 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 793 810 N/A INTRINSIC
transmembrane domain 884 906 N/A INTRINSIC
transmembrane domain 919 941 N/A INTRINSIC
transmembrane domain 956 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in glycosylphosphatidylinositol-anchor biosynthesis. The encoded protein, which is localized to the endoplasmic reticulum, is involved in transferring ethanoloamine phosphate to mannose 2 of glycosylphosphatidylinositol species H7 to form species H8. Allelic variants of this gene have been associated with intellectual disability, hypotonia, and early-onset seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Pigg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Pigg APN 5 108342078 missense probably damaging 1.00
IGL01308:Pigg APN 5 108336477 missense probably damaging 1.00
IGL01485:Pigg APN 5 108336201 missense possibly damaging 0.90
IGL02043:Pigg APN 5 108344324 missense probably damaging 1.00
IGL02104:Pigg APN 5 108342097 missense probably damaging 1.00
IGL02238:Pigg APN 5 108318928 missense possibly damaging 0.64
IGL02311:Pigg APN 5 108336380 missense probably benign
IGL02608:Pigg APN 5 108313003 missense probably damaging 0.98
IGL03338:Pigg APN 5 108319950 missense probably damaging 1.00
P0033:Pigg UTSW 5 108342078 missense probably damaging 1.00
R0082:Pigg UTSW 5 108312885 start gained probably benign
R0449:Pigg UTSW 5 108336411 missense probably benign 0.00
R0616:Pigg UTSW 5 108314085 missense probably damaging 1.00
R1246:Pigg UTSW 5 108341820 missense probably damaging 0.99
R1368:Pigg UTSW 5 108317288 missense probably damaging 1.00
R1777:Pigg UTSW 5 108317391 missense probably damaging 1.00
R1898:Pigg UTSW 5 108336542 missense probably benign
R2022:Pigg UTSW 5 108312922 start gained probably benign
R2157:Pigg UTSW 5 108318889 missense probably damaging 1.00
R2181:Pigg UTSW 5 108336500 missense probably damaging 0.96
R2291:Pigg UTSW 5 108332917 missense probably damaging 0.97
R3157:Pigg UTSW 5 108314148 missense probably damaging 1.00
R4117:Pigg UTSW 5 108348042 missense probably benign 0.15
R4572:Pigg UTSW 5 108332885 missense probably benign 0.27
R4589:Pigg UTSW 5 108332690 missense probably benign
R5019:Pigg UTSW 5 108332149 missense probably damaging 1.00
R5094:Pigg UTSW 5 108336257 missense possibly damaging 0.90
R5329:Pigg UTSW 5 108314160 missense probably damaging 0.99
R5960:Pigg UTSW 5 108336294 missense probably benign 0.01
R5976:Pigg UTSW 5 108332191 missense probably null 1.00
R6089:Pigg UTSW 5 108341922 missense probably benign
R6797:Pigg UTSW 5 108332828 missense probably damaging 0.99
R6960:Pigg UTSW 5 108326841 missense probably damaging 0.98
R7090:Pigg UTSW 5 108336512 missense possibly damaging 0.92
R7659:Pigg UTSW 5 108338619 missense probably benign 0.03
R7660:Pigg UTSW 5 108338619 missense probably benign 0.03
R7661:Pigg UTSW 5 108338619 missense probably benign 0.03
R7732:Pigg UTSW 5 108318975 missense probably benign 0.00
R7749:Pigg UTSW 5 108336296 missense probably benign
R7765:Pigg UTSW 5 108314054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGTGAATGAGATCTCAGTATGG -3'
(R):5'- AACTCAAGTACTGTAAGGCCTGG -3'

Sequencing Primer
(F):5'- GATCTCAGTATGGTAATCTTTGTGAC -3'
(R):5'- CCTGGCACGGCATTGTTAGTAC -3'
Posted On2014-08-25