Incidental Mutation 'R1999:Gpld1'
ID224775
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Nameglycosylphosphatidylinositol specific phospholipase D1
Synonyms6330541J12Rik
MMRRC Submission 040009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1999 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24943152-24992501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24962647 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 225 (V225A)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021773]
Predicted Effect probably benign
Transcript: ENSMUST00000021773
AA Change: V225A

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: V225A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223873
Meta Mutation Damage Score 0.0971 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,908,211 T487I probably damaging Het
Acot1 T A 12: 84,009,753 W82R probably damaging Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Ambp C T 4: 63,149,429 M181I possibly damaging Het
Anln A G 9: 22,333,052 *1122Q probably null Het
Apc2 C T 10: 80,309,160 T635I probably damaging Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Ceacam5 A T 7: 17,747,247 K306N possibly damaging Het
Cep295nl T C 11: 118,333,089 R310G probably damaging Het
Ces2h A G 8: 105,020,345 T538A probably benign Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Diaph3 T A 14: 86,984,866 D405V possibly damaging Het
Dync1h1 T C 12: 110,666,423 probably null Het
Epha7 C T 4: 28,938,686 Q514* probably null Het
Etfb C T 7: 43,454,563 L141F probably benign Het
Fat1 T C 8: 44,952,393 V727A probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Fndc3c1 C T X: 106,420,705 E1276K probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm9268 A T 7: 43,047,459 I647F probably damaging Het
Herc1 A G 9: 66,486,078 T4080A probably benign Het
Hoxa3 A C 6: 52,170,402 Y290* probably null Het
Htr5a G A 5: 27,850,889 V293M possibly damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Kcnq5 T C 1: 21,402,204 S811G probably null Het
Kcnt1 T A 2: 25,892,360 H156Q probably benign Het
Kif1a T C 1: 93,060,795 N507S probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Manea A G 4: 26,327,871 L390P probably damaging Het
Mboat2 A G 12: 24,946,673 D225G possibly damaging Het
Medag T A 5: 149,427,252 F64Y probably damaging Het
Mtmr6 T A 14: 60,293,407 S331R probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Nomo1 T C 7: 46,056,727 S502P possibly damaging Het
Olfr1076 T A 2: 86,508,745 Y95* probably null Het
Olfr401 A G 11: 74,121,580 Y97C probably benign Het
Olfr981 A G 9: 40,022,689 I99V probably benign Het
Otof T A 5: 30,388,772 E427D probably benign Het
Pclo T C 5: 14,677,080 probably benign Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Rad21l T C 2: 151,654,701 probably null Het
Rbbp6 T C 7: 122,990,352 V459A probably damaging Het
Rsbn1l G A 5: 20,902,370 H549Y probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Slc44a5 T C 3: 154,258,493 F499L possibly damaging Het
Slitrk3 C T 3: 73,049,964 V492I probably benign Het
Spef2 T A 15: 9,668,903 probably null Het
Ssc5d A T 7: 4,942,714 D915V possibly damaging Het
Stard9 A G 2: 120,692,868 D668G probably damaging Het
Sycp2l A G 13: 41,118,304 D73G probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Tmem8b G A 4: 43,681,300 C439Y probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn1r74 G T 7: 11,847,375 V201F probably damaging Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 24986922 splice site probably benign
IGL00886:Gpld1 APN 13 24962353 nonsense probably null
IGL01060:Gpld1 APN 13 24982566 missense probably damaging 1.00
IGL01450:Gpld1 APN 13 24979681 missense probably damaging 1.00
IGL02176:Gpld1 APN 13 24984209 critical splice donor site probably null
IGL02288:Gpld1 APN 13 24979683 nonsense probably null
IGL02323:Gpld1 APN 13 24982774 missense probably damaging 0.97
IGL02588:Gpld1 APN 13 24943699 missense probably damaging 1.00
IGL02832:Gpld1 APN 13 24952878 missense probably damaging 1.00
IGL02989:Gpld1 APN 13 24990036 missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 24971408 missense probably benign 0.01
IGL03345:Gpld1 APN 13 24987024 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0308:Gpld1 UTSW 13 24962835 missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 24962320 nonsense probably null
R1172:Gpld1 UTSW 13 24957566 splice site probably null
R1411:Gpld1 UTSW 13 24962808 missense probably damaging 0.99
R1502:Gpld1 UTSW 13 24971416 missense probably benign 0.00
R1565:Gpld1 UTSW 13 24956068 missense probably damaging 0.99
R1931:Gpld1 UTSW 13 24943710 missense possibly damaging 0.71
R2150:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2240:Gpld1 UTSW 13 24982507 critical splice acceptor site probably null
R2327:Gpld1 UTSW 13 24984821 missense probably benign 0.00
R2373:Gpld1 UTSW 13 24962856 missense probably benign 0.26
R3153:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24956163 critical splice donor site probably null
R3911:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R4616:Gpld1 UTSW 13 24984816 missense probably damaging 1.00
R4660:Gpld1 UTSW 13 24982603 unclassified probably null
R4755:Gpld1 UTSW 13 24979688 missense probably benign 0.13
R4755:Gpld1 UTSW 13 24979692 nonsense probably null
R4835:Gpld1 UTSW 13 24982716 missense probably benign 0.00
R4895:Gpld1 UTSW 13 24979728 missense probably damaging 0.97
R5050:Gpld1 UTSW 13 24962756 missense probably benign 0.00
R5182:Gpld1 UTSW 13 24984070 unclassified probably null
R6161:Gpld1 UTSW 13 24971414 missense probably benign 0.00
R6626:Gpld1 UTSW 13 24979970 missense probably damaging 1.00
R7021:Gpld1 UTSW 13 24984708 missense probably damaging 1.00
R7577:Gpld1 UTSW 13 24962405 missense probably benign 0.05
R7583:Gpld1 UTSW 13 24975760 missense probably damaging 1.00
R7659:Gpld1 UTSW 13 24979981 missense probably benign 0.00
R7737:Gpld1 UTSW 13 24975726 missense probably damaging 1.00
R7738:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R7752:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
R7759:Gpld1 UTSW 13 24962400 missense probably damaging 0.99
X0024:Gpld1 UTSW 13 24982596 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGGAAATGTAAGTGTGGAC -3'
(R):5'- TCGTGGACCAGAATGCCATG -3'

Sequencing Primer
(F):5'- ACCAGAAGGGACCTCTCTGAG -3'
(R):5'- GTGGACCAGAATGCCATGTCATC -3'
Posted On2014-08-25