Incidental Mutation 'R2037:AI987944'
ID224783
Institutional Source Beutler Lab
Gene Symbol AI987944
Ensembl Gene ENSMUSG00000056383
Gene Nameexpressed sequence AI987944
Synonyms
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41372923-41393379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41374391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 391 (Y391C)
Ref Sequence ENSEMBL: ENSMUSP00000071708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071804] [ENSMUST00000205338] [ENSMUST00000206801]
Predicted Effect probably benign
Transcript: ENSMUST00000071804
AA Change: Y391C

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071708
Gene: ENSMUSG00000056383
AA Change: Y391C

DomainStartEndE-ValueType
KRAB 4 65 8.72e-15 SMART
ZnF_C2H2 74 96 1.24e2 SMART
ZnF_C2H2 130 152 2.43e-4 SMART
ZnF_C2H2 181 203 5.21e-4 SMART
ZnF_C2H2 209 231 3.95e-4 SMART
ZnF_C2H2 237 259 1.95e-3 SMART
ZnF_C2H2 265 287 4.87e-4 SMART
ZnF_C2H2 293 315 1.72e-4 SMART
ZnF_C2H2 321 343 8.47e-4 SMART
ZnF_C2H2 349 371 9.73e-4 SMART
ZnF_C2H2 377 399 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205338
AA Change: Y388C

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000206801
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in AI987944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03350:AI987944 APN 7 41393237 utr 5 prime probably benign
R0744:AI987944 UTSW 7 41376859 missense probably damaging 1.00
R1083:AI987944 UTSW 7 41375339 missense probably benign 0.09
R1480:AI987944 UTSW 7 41374919 missense probably benign 0.00
R1485:AI987944 UTSW 7 41374530 nonsense probably null
R1491:AI987944 UTSW 7 41374348 nonsense probably null
R1662:AI987944 UTSW 7 41374449 missense possibly damaging 0.79
R1892:AI987944 UTSW 7 41374596 missense probably damaging 1.00
R1906:AI987944 UTSW 7 41375126 missense probably benign 0.02
R2092:AI987944 UTSW 7 41374617 missense possibly damaging 0.58
R2202:AI987944 UTSW 7 41374526 missense probably damaging 0.98
R5070:AI987944 UTSW 7 41375324 missense probably benign 0.23
R5421:AI987944 UTSW 7 41374776 missense probably benign 0.02
R5531:AI987944 UTSW 7 41374390 nonsense probably null
R6822:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R7039:AI987944 UTSW 7 41374456 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGATGTGTAAAGGCATTAACAG -3'
(R):5'- TTTAGGCGGCACAATACCC -3'

Sequencing Primer
(F):5'- AGGCATTAACAGATAACATCAAAGG -3'
(R):5'- TGCGATCAATGTGATAAAGCC -3'
Posted On2014-08-25