Incidental Mutation 'R2037:Myo9b'
ID224791
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Namemyosin IXb
Synonyms
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71272714-71360713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 71290866 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 190 (K190N)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: K190N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: K190N

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168839
AA Change: K190N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: K190N

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: K190N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: K190N

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212935
AA Change: K190N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71348735 missense probably benign
IGL01020:Myo9b APN 8 71352000 missense probably benign
IGL01479:Myo9b APN 8 71359342 missense probably damaging 1.00
IGL01704:Myo9b APN 8 71359642 missense probably damaging 0.98
IGL01761:Myo9b APN 8 71349152 missense probably damaging 0.96
IGL01766:Myo9b APN 8 71290517 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71356318 missense probably damaging 1.00
IGL01834:Myo9b APN 8 71355257 missense possibly damaging 0.93
IGL01838:Myo9b APN 8 71334390 missense probably damaging 0.99
IGL02318:Myo9b APN 8 71354124 missense probably damaging 0.98
IGL02333:Myo9b APN 8 71358993 missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71291045 missense probably damaging 1.00
IGL02514:Myo9b APN 8 71291006 missense probably damaging 1.00
IGL02593:Myo9b APN 8 71290773 missense probably damaging 1.00
IGL03075:Myo9b APN 8 71354527 missense probably damaging 1.00
IGL03332:Myo9b APN 8 71348774 missense possibly damaging 0.78
avantgarde UTSW 8 71344162 missense probably damaging 1.00
Freaky UTSW 8 71290819 missense probably damaging 1.00
iconoclastic UTSW 8 71290475 missense probably benign 0.37
unconventional UTSW 8 71348597 missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71322947 missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71342812 missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71333768 missense probably damaging 1.00
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0103:Myo9b UTSW 8 71323849 splice site probably benign
R0144:Myo9b UTSW 8 71346043 missense probably damaging 1.00
R0207:Myo9b UTSW 8 71355225 splice site probably benign
R0226:Myo9b UTSW 8 71353832 missense probably damaging 1.00
R0227:Myo9b UTSW 8 71344162 missense probably damaging 1.00
R0244:Myo9b UTSW 8 71321813 missense probably damaging 1.00
R0277:Myo9b UTSW 8 71355952 splice site probably benign
R0362:Myo9b UTSW 8 71347770 missense probably damaging 1.00
R0689:Myo9b UTSW 8 71330756 missense probably damaging 1.00
R0844:Myo9b UTSW 8 71290475 missense probably benign 0.37
R1051:Myo9b UTSW 8 71355822 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1469:Myo9b UTSW 8 71291036 missense probably damaging 1.00
R1526:Myo9b UTSW 8 71355764 missense probably damaging 1.00
R1544:Myo9b UTSW 8 71290976 missense probably damaging 1.00
R1565:Myo9b UTSW 8 71315192 missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71322978 missense probably damaging 1.00
R1745:Myo9b UTSW 8 71354047 missense probably damaging 1.00
R1820:Myo9b UTSW 8 71333358 missense probably damaging 1.00
R2050:Myo9b UTSW 8 71290550 missense probably damaging 1.00
R2056:Myo9b UTSW 8 71359690 missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71333699 missense probably damaging 1.00
R2423:Myo9b UTSW 8 71327940 missense probably damaging 1.00
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2869:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2871:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2872:Myo9b UTSW 8 71290966 missense probably benign 0.01
R2873:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2874:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2920:Myo9b UTSW 8 71325857 missense probably damaging 0.98
R2926:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2939:Myo9b UTSW 8 71334337 missense probably benign 0.01
R2940:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3033:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3040:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3689:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3691:Myo9b UTSW 8 71334337 missense probably benign 0.01
R3735:Myo9b UTSW 8 71348597 missense probably benign 0.00
R4194:Myo9b UTSW 8 71359624 missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71355765 missense probably damaging 1.00
R4457:Myo9b UTSW 8 71290999 missense probably damaging 1.00
R4478:Myo9b UTSW 8 71291081 missense probably damaging 1.00
R4496:Myo9b UTSW 8 71334337 missense probably benign 0.01
R4544:Myo9b UTSW 8 71327941 missense probably damaging 1.00
R4580:Myo9b UTSW 8 71315135 missense probably damaging 1.00
R4736:Myo9b UTSW 8 71356592 missense probably damaging 1.00
R5068:Myo9b UTSW 8 71349055 missense probably damaging 1.00
R5124:Myo9b UTSW 8 71355839 missense probably damaging 1.00
R5194:Myo9b UTSW 8 71349089 missense probably benign 0.01
R5296:Myo9b UTSW 8 71333388 missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71323274 missense probably benign 0.06
R5664:Myo9b UTSW 8 71359882 missense probably benign 0.13
R5677:Myo9b UTSW 8 71343686 missense probably damaging 1.00
R5680:Myo9b UTSW 8 71290372 missense probably benign 0.00
R5982:Myo9b UTSW 8 71348396 missense probably benign 0.05
R6344:Myo9b UTSW 8 71327914 missense probably damaging 1.00
R6352:Myo9b UTSW 8 71348410 missense probably benign 0.16
R6352:Myo9b UTSW 8 71348411 missense probably benign
R6411:Myo9b UTSW 8 71322955 nonsense probably null
R6425:Myo9b UTSW 8 71333628 missense probably damaging 1.00
R6505:Myo9b UTSW 8 71355857 missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71352159 splice site probably null
R6811:Myo9b UTSW 8 71356578 missense probably damaging 1.00
R6813:Myo9b UTSW 8 71323305 missense probably damaging 1.00
R6954:Myo9b UTSW 8 71290819 missense probably damaging 1.00
R7124:Myo9b UTSW 8 71333701 nonsense probably null
R7255:Myo9b UTSW 8 71290891 missense probably damaging 1.00
R7293:Myo9b UTSW 8 71325905 missense probably benign 0.00
R7342:Myo9b UTSW 8 71355774 missense probably damaging 1.00
R7451:Myo9b UTSW 8 71352188 missense probably benign 0.28
R7482:Myo9b UTSW 8 71342798 missense probably benign 0.00
R7508:Myo9b UTSW 8 71354801 missense probably benign 0.00
R7957:Myo9b UTSW 8 71354761 missense probably benign 0.12
R8062:Myo9b UTSW 8 71321813 missense probably damaging 0.99
R8108:Myo9b UTSW 8 71348342 missense probably damaging 0.99
R8197:Myo9b UTSW 8 71290963 missense probably damaging 1.00
R8274:Myo9b UTSW 8 71359836 missense probably benign 0.00
X0066:Myo9b UTSW 8 71323898 missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71290709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAGTATTCAGTACCTGC -3'
(R):5'- TGCTCTGTGTCTTGCCAGAG -3'

Sequencing Primer
(F):5'- GGCAGTATTCAGTACCTGCCCATAC -3'
(R):5'- GTGTCTTGCCAGAGCCACTC -3'
Posted On2014-08-25