Mutagenetix > Incidental Mutations

Incidental Mutation 'R1990:Unc80'

224807

Institutional Source

Beutler Lab

Gene Symbol

Unc80

Ensembl Gene

ENSMUSG00000055567

Gene Name

unc-80, NALCN activator

Synonyms

C030018G13Rik, C230061B10Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.895) question?

Stock #

R1990 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66468367-66699148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66692549 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 3053 (L3053P)

Ref Sequence

ENSEMBL: ENSMUSP00000148517 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061620
AA Change: L3121P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: L3121P

Domain	Start	End	E-Value	Type
Pfam:UNC80	16	236	2.2e-94	PFAM
low complexity region	372	385	N/A	INTRINSIC
low complexity region	493	502	N/A	INTRINSIC
low complexity region	693	711	N/A	INTRINSIC
low complexity region	723	738	N/A	INTRINSIC
low complexity region	739	769	N/A	INTRINSIC
low complexity region	1038	1055	N/A	INTRINSIC
low complexity region	1067	1084	N/A	INTRINSIC
low complexity region	1309	1328	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1676	1681	N/A	INTRINSIC
low complexity region	1842	1848	N/A	INTRINSIC
low complexity region	1854	1868	N/A	INTRINSIC
low complexity region	2461	2480	N/A	INTRINSIC
low complexity region	2726	2740	N/A	INTRINSIC
low complexity region	3121	3144	N/A	INTRINSIC
low complexity region	3245	3254	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000152844
AA Change: L75P

SMART Domains

Protein: ENSMUSP00000117070
Gene: ENSMUSG00000055567
AA Change: L75P

Domain	Start	End	E-Value	Type
low complexity region	76	99	N/A	INTRINSIC
low complexity region	200	209	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192513

Predicted Effect

probably damaging
Transcript: ENSMUST00000212557
AA Change: L3053P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,658	R203*	probably null	Het
9530053A07Rik	A	T	7: 28,154,360	D1583V	probably damaging	Het
Acp6	T	C	3: 97,175,738	L355P	probably damaging	Het
Aebp2	T	C	6: 140,633,738	S234P	probably damaging	Het
Anapc7	A	G	5: 122,439,504	D374G	probably benign	Het
Apob	A	T	12: 8,001,039	I1088F	probably damaging	Het
Arid4b	T	C	13: 14,132,436	V92A	probably damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Asxl2	G	T	12: 3,484,558	G252*	probably null	Het
Atl1	A	T	12: 69,963,328	K556M	probably damaging	Het
AU018091	A	G	7: 3,162,264	V206A	probably benign	Het
Bcas1	A	T	2: 170,370,477	D383E	possibly damaging	Het
Bmx	A	G	X: 164,232,196	W257R	probably benign	Het
Bpifb6	T	C	2: 153,905,350		probably null	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Cand1	A	G	10: 119,210,067	S978P	probably damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Caps2	G	A	10: 112,200,686	A384T	probably benign	Het
Catsperg2	A	T	7: 29,721,045	Y223*	probably null	Het
Cd81	G	T	7: 143,067,201	G206*	probably null	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdkn2aip	G	T	8: 47,712,176	N167K	probably benign	Het
Ceacam14	T	A	7: 17,815,365	L227*	probably null	Het
Ceacam5	A	T	7: 17,757,880	D725V	probably damaging	Het
Cldn34a	A	T	X: 152,563,845	H171L	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cp	A	G	3: 19,979,013	D667G	probably damaging	Het
Cr2	G	A	1: 195,154,150	P1278S	possibly damaging	Het
Crat	A	G	2: 30,405,048	Y452H	possibly damaging	Het
Cyp4f13	T	A	17: 32,925,568	H318L	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dmbt1	A	G	7: 131,058,288	N527S	probably damaging	Het
Fgb	G	T	3: 83,044,253	Y256*	probably null	Het
Frmd3	T	A	4: 74,187,439	S441T	probably damaging	Het
Glp1r	T	A	17: 30,930,748	C329S	possibly damaging	Het
Gm13088	T	A	4: 143,654,268	Y395F	probably damaging	Het
Gm13757	A	G	2: 88,446,689	L83P	probably damaging	Het
Gm14190	G	T	11: 99,690,605	Q46K	unknown	Het
Golt1b	T	A	6: 142,392,354	F17Y	probably damaging	Het
Gsdmc	A	G	15: 63,801,899	I179T	probably benign	Het
Gsdmc2	T	A	15: 63,828,237	M229L	probably benign	Het
Gulp1	A	C	1: 44,766,114	N121T	possibly damaging	Het
Ift122	T	A	6: 115,924,367	F1037I	probably damaging	Het
Ildr1	A	T	16: 36,716,206	Y199F	probably damaging	Het
Ints2	T	A	11: 86,248,934	H278L	possibly damaging	Het
Invs	T	C	4: 48,392,599	V271A	possibly damaging	Het
Kcnj2	T	C	11: 111,072,883	I367T	probably benign	Het
Kif21b	T	C	1: 136,161,770	S1115P	probably damaging	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Lcmt2	C	A	2: 121,140,281	R107L	probably benign	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lrrc9	A	C	12: 72,497,861	R71S	probably damaging	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mis18bp1	T	C	12: 65,158,694	T235A	probably benign	Het
Mta2	C	T	19: 8,942,332		probably benign	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nek10	A	G	14: 14,860,764	T467A	probably benign	Het
Nexn	A	T	3: 152,252,939	F106I	probably damaging	Het
Nrd1	T	A	4: 109,039,775	Y282*	probably null	Het
Nxf3	G	A	X: 136,075,834	P380S	possibly damaging	Het
Olfr1183	A	G	2: 88,461,342	M1V	probably null	Het
Olfr1426	C	A	19: 12,088,256	V179F	probably damaging	Het
Olfr403	T	C	11: 74,196,163	V220A	probably damaging	Het
Olfr490	C	A	7: 108,286,359	G256*	probably null	Het
Olfr495	A	G	7: 108,395,834	Y238C	probably benign	Het
Olfr643	A	T	7: 104,059,128	I158N	possibly damaging	Het
Olfr685	A	T	7: 105,181,014	C115S	probably damaging	Het
Oma1	C	T	4: 103,321,774	T208I	probably damaging	Het
Panx2	A	T	15: 89,069,738	Y632F	possibly damaging	Het
Pdia4	T	C	6: 47,796,655	T587A	probably benign	Het
Piezo2	A	T	18: 63,074,662	L1426Q	probably null	Het
Pigk	T	A	3: 152,744,494	Y212N	probably damaging	Het
Prl3b1	C	T	13: 27,245,792	T71I	possibly damaging	Het
Rab3gap1	A	G	1: 127,942,429	E929G	possibly damaging	Het
Rabl3	T	C	16: 37,563,717	I162T	probably benign	Het
Rasgrf2	T	A	13: 92,035,965	T188S	probably damaging	Het
Slc12a2	A	G	18: 57,910,286	I601V	possibly damaging	Het
Slc25a42	A	T	8: 70,191,869	I60N	probably benign	Het
Slc2a3	C	T	6: 122,736,735	G173S	probably damaging	Het
Slc46a3	G	A	5: 147,886,594	T146M	probably damaging	Het
Specc1	C	A	11: 62,029,294	P7T	possibly damaging	Het
Sptbn4	T	C	7: 27,423,810	D229G	probably benign	Het
Sspo	T	C	6: 48,451,050	I154T	probably benign	Het
Stx5a	T	C	19: 8,748,890		probably null	Het
Stxbp6	A	T	12: 44,855,857	C210*	probably null	Het
Tagap1	C	T	17: 6,956,886	R137Q	probably benign	Het
Tbc1d9	A	G	8: 83,271,303	Y1163C	probably damaging	Het
Tex14	T	G	11: 87,549,470	L1367R	probably damaging	Het
Tnnt3	C	T	7: 142,511,525	R131C	possibly damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Ttc28	C	T	5: 111,276,322	S1485L	probably benign	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Wars	G	T	12: 108,888,433	N18K	possibly damaging	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Xndc1	T	A	7: 102,073,191	V21E	probably damaging	Het
Zfp493	T	A	13: 67,786,269	C114S	probably damaging	Het

Other mutations in Unc80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Unc80	APN	1	66654395	missense	possibly damaging	0.53
IGL00340:Unc80	APN	1	66606459	missense	possibly damaging	0.73
IGL00783:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00784:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00935:Unc80	APN	1	66627266	missense	possibly damaging	0.53
IGL01094:Unc80	APN	1	66695433	missense	possibly damaging	0.90
IGL01466:Unc80	APN	1	66622486	missense	probably benign	0.33
IGL01577:Unc80	APN	1	66529968	splice site	probably null
IGL01626:Unc80	APN	1	66551054	critical splice donor site	probably null
IGL01640:Unc80	APN	1	66679585	missense	probably benign	0.33
IGL01775:Unc80	APN	1	66601056	missense	possibly damaging	0.94
IGL01960:Unc80	APN	1	66608500	splice site	probably benign
IGL01991:Unc80	APN	1	66469509	nonsense	probably null
IGL02022:Unc80	APN	1	66626516	missense	possibly damaging	0.53
IGL02073:Unc80	APN	1	66612227	missense	possibly damaging	0.85
IGL02077:Unc80	APN	1	66525716	missense	possibly damaging	0.77
IGL02197:Unc80	APN	1	66530065	missense	probably benign	0.39
IGL02198:Unc80	APN	1	66529986	missense	possibly damaging	0.88
IGL02228:Unc80	APN	1	66608428	missense	possibly damaging	0.72
IGL02327:Unc80	APN	1	66641673	missense	probably benign	0.33
IGL02447:Unc80	APN	1	66503544	missense	possibly damaging	0.86
IGL02489:Unc80	APN	1	66525701	missense	probably benign	0.07
IGL02546:Unc80	APN	1	66554953	missense	possibly damaging	0.83
IGL02629:Unc80	APN	1	66483317	missense	possibly damaging	0.46
IGL02631:Unc80	APN	1	66530063	missense	probably damaging	0.98
IGL02839:Unc80	APN	1	66671675	missense	possibly damaging	0.53
IGL02960:Unc80	APN	1	66678058	splice site	probably benign
IGL02974:Unc80	APN	1	66525658	missense	possibly damaging	0.95
IGL03060:Unc80	APN	1	66637010	missense	possibly damaging	0.96
IGL03062:Unc80	APN	1	66509489	missense	probably damaging	0.96
IGL03074:Unc80	APN	1	66671718	splice site	probably benign
IGL03086:Unc80	APN	1	66509474	missense	probably damaging	0.99
IGL03105:Unc80	APN	1	66472099	missense	probably damaging	0.96
IGL03107:Unc80	APN	1	66631454	missense	probably damaging	0.98
IGL03158:Unc80	APN	1	66641674	missense	probably benign	0.33
IGL03220:Unc80	APN	1	66504938	missense	probably damaging	0.99
IGL03271:Unc80	APN	1	66695603	unclassified	probably benign
IGL03332:Unc80	APN	1	66503631	missense	probably damaging	1.00
IGL03347:Unc80	APN	1	66695466	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0026:Unc80	UTSW	1	66521584	missense	probably benign	0.27
R0055:Unc80	UTSW	1	66506623	splice site	probably benign
R0149:Unc80	UTSW	1	66521601	missense	possibly damaging	0.82
R0325:Unc80	UTSW	1	66510881	missense	probably damaging	1.00
R0329:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0330:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0355:Unc80	UTSW	1	66549856	missense	possibly damaging	0.77
R0412:Unc80	UTSW	1	66550937	splice site	probably benign
R0422:Unc80	UTSW	1	66483338	missense	probably damaging	1.00
R0477:Unc80	UTSW	1	66570001	missense	probably damaging	0.99
R0507:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0513:Unc80	UTSW	1	66622474	missense	possibly damaging	0.73
R0553:Unc80	UTSW	1	66506669	missense	probably damaging	0.97
R0626:Unc80	UTSW	1	66608442	missense	probably benign	0.01
R0655:Unc80	UTSW	1	66503781	missense	probably damaging	0.98
R0742:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0755:Unc80	UTSW	1	66504923	missense	probably damaging	1.00
R0782:Unc80	UTSW	1	66622581	missense	possibly damaging	0.53
R0837:Unc80	UTSW	1	66648944	missense	possibly damaging	0.73
R0841:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R0893:Unc80	UTSW	1	66521486	missense	probably damaging	0.97
R0900:Unc80	UTSW	1	66671598	missense	probably benign	0.33
R0924:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0930:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0989:Unc80	UTSW	1	66646440	missense	possibly damaging	0.53
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1224:Unc80	UTSW	1	66471980	missense	probably damaging	1.00
R1240:Unc80	UTSW	1	66635902	missense	possibly damaging	0.85
R1245:Unc80	UTSW	1	66555095	missense	possibly damaging	0.94
R1467:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1473:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1500:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1556:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1562:Unc80	UTSW	1	66637957	missense	probably damaging	1.00
R1655:Unc80	UTSW	1	66672756	missense	possibly damaging	0.86
R1674:Unc80	UTSW	1	66509308	missense	probably damaging	1.00
R1680:Unc80	UTSW	1	66503669	nonsense	probably null
R1739:Unc80	UTSW	1	66527892	missense	probably damaging	0.97
R1756:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1783:Unc80	UTSW	1	66683273	missense	probably benign	0.01
R1834:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1854:Unc80	UTSW	1	66631414	missense	possibly damaging	0.93
R1871:Unc80	UTSW	1	66510717	missense	possibly damaging	0.77
R1878:Unc80	UTSW	1	66509402	missense	probably damaging	0.96
R1883:Unc80	UTSW	1	66525770	missense	possibly damaging	0.89
R1912:Unc80	UTSW	1	66510625	missense	probably damaging	1.00
R2007:Unc80	UTSW	1	66503776	missense	probably damaging	1.00
R2035:Unc80	UTSW	1	66606593	missense	probably damaging	0.98
R2056:Unc80	UTSW	1	66640552	missense	possibly damaging	0.72
R2060:Unc80	UTSW	1	66640595	missense	possibly damaging	0.53
R2074:Unc80	UTSW	1	66679744	critical splice donor site	probably null
R2088:Unc80	UTSW	1	66590227	missense	possibly damaging	0.77
R2089:Unc80	UTSW	1	66671715	splice site	probably benign
R2091:Unc80	UTSW	1	66671715	splice site	probably benign
R2139:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2169:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2175:Unc80	UTSW	1	66677355	missense	probably damaging	1.00
R2248:Unc80	UTSW	1	66623206	splice site	probably benign
R2255:Unc80	UTSW	1	66618258	missense	possibly damaging	0.53
R2308:Unc80	UTSW	1	66648997	missense	possibly damaging	0.53
R2484:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2507:Unc80	UTSW	1	66612107	missense	possibly damaging	0.53
R2512:Unc80	UTSW	1	66671608	missense	possibly damaging	0.70
R2878:Unc80	UTSW	1	66671576	critical splice acceptor site	probably benign
R3040:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3104:Unc80	UTSW	1	66623291	missense	probably benign	0.33
R3402:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3403:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3413:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3426:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3427:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3428:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3904:Unc80	UTSW	1	66639296	nonsense	probably null
R3916:Unc80	UTSW	1	66677495	missense	probably benign	0.11
R3950:Unc80	UTSW	1	66622570	missense	possibly damaging	0.53
R4642:Unc80	UTSW	1	66671714	splice site	probably null
R4646:Unc80	UTSW	1	66669235	missense	probably benign	0.03
R4655:Unc80	UTSW	1	66671662	missense	probably benign	0.18
R4662:Unc80	UTSW	1	66646436	missense	probably benign	0.01
R4720:Unc80	UTSW	1	66510792	missense	possibly damaging	0.92
R4736:Unc80	UTSW	1	66649672	critical splice acceptor site	probably null
R4795:Unc80	UTSW	1	66527941	missense	probably damaging	0.97
R4888:Unc80	UTSW	1	66644447	missense	probably damaging	0.98
R4917:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4918:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4983:Unc80	UTSW	1	66674732	intron	probably null
R5051:Unc80	UTSW	1	66509477	missense	probably damaging	0.96
R5111:Unc80	UTSW	1	66527995	missense	possibly damaging	0.66
R5122:Unc80	UTSW	1	66679590	missense	possibly damaging	0.53
R5260:Unc80	UTSW	1	66646587	missense	possibly damaging	0.53
R5351:Unc80	UTSW	1	66606513	missense	possibly damaging	0.73
R5387:Unc80	UTSW	1	66530021	missense	possibly damaging	0.77
R5437:Unc80	UTSW	1	66654578	missense	possibly damaging	0.96
R5525:Unc80	UTSW	1	66606614	missense	possibly damaging	0.72
R5621:Unc80	UTSW	1	66638043	missense	possibly damaging	0.53
R5690:Unc80	UTSW	1	66640572	missense	probably benign	0.08
R5762:Unc80	UTSW	1	66693796	missense	possibly damaging	0.82
R5956:Unc80	UTSW	1	66527964	missense	probably damaging	0.97
R6005:Unc80	UTSW	1	66627257	missense	possibly damaging	0.53
R6025:Unc80	UTSW	1	66695568	missense	possibly damaging	0.90
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6117:Unc80	UTSW	1	66675067	missense	possibly damaging	0.72
R6156:Unc80	UTSW	1	66612250	missense	probably benign	0.01
R6157:Unc80	UTSW	1	66654029	nonsense	probably null
R6189:Unc80	UTSW	1	66677471	missense	probably benign	0.33
R6291:Unc80	UTSW	1	66521597	missense	possibly damaging	0.82
R6367:Unc80	UTSW	1	66672766	missense	probably benign	0.33
R6598:Unc80	UTSW	1	66468540	critical splice donor site	probably null
R6724:Unc80	UTSW	1	66683191	missense	possibly damaging	0.90
R6763:Unc80	UTSW	1	66521477	missense	probably benign	0.00
R6773:Unc80	UTSW	1	66651543	missense	probably benign	0.33
R6883:Unc80	UTSW	1	66646404	missense	probably benign	0.33
R6951:Unc80	UTSW	1	66648511	missense	possibly damaging	0.53
R6965:Unc80	UTSW	1	66646566	missense	probably benign	0.33
R6993:Unc80	UTSW	1	66549793	missense	possibly damaging	0.60
R7041:Unc80	UTSW	1	66503593	missense	probably benign	0.00
R7050:Unc80	UTSW	1	66550908	intron	probably null
R7067:Unc80	UTSW	1	66646572	missense	possibly damaging	0.86
R7080:Unc80	UTSW	1	66646521	missense	possibly damaging	0.53
R7193:Unc80	UTSW	1	66549784	missense	possibly damaging	0.60
R7197:Unc80	UTSW	1	66521566	nonsense	probably null
R7278:Unc80	UTSW	1	66552209	missense	possibly damaging	0.82
R7290:Unc80	UTSW	1	66601197	missense	probably damaging	0.97
R7391:Unc80	UTSW	1	66695528	missense	probably benign	0.18
R7401:Unc80	UTSW	1	66646415	missense	possibly damaging	0.96
R7470:Unc80	UTSW	1	66622462	missense	probably benign	0.02
R7573:Unc80	UTSW	1	66521537	missense	probably damaging	1.00
R7637:Unc80	UTSW	1	66672684	missense	possibly damaging	0.86
R7678:Unc80	UTSW	1	66649722	missense	probably benign	0.33
R7697:Unc80	UTSW	1	66637945	missense	possibly damaging	0.93
R7746:Unc80	UTSW	1	66677385	missense	probably benign	0.33
R7768:Unc80	UTSW	1	66510595	missense	possibly damaging	0.56
R7796:Unc80	UTSW	1	66503714	missense	probably benign
R7855:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7878:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7879:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R7938:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7961:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7962:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R8024:Unc80	UTSW	1	66606644	missense	possibly damaging	0.86
R8026:Unc80	UTSW	1	66483304	missense	possibly damaging	0.92
R8115:Unc80	UTSW	1	66648913	missense	probably benign	0.00
R8135:Unc80	UTSW	1	66509287	missense	possibly damaging	0.49
X0019:Unc80	UTSW	1	66648382	missense	probably benign	0.33
X0021:Unc80	UTSW	1	66509266	critical splice acceptor site	probably null
X0024:Unc80	UTSW	1	66491046	missense	probably benign	0.21
X0062:Unc80	UTSW	1	66623259	missense	probably benign	0.02
X0066:Unc80	UTSW	1	66530757	missense	possibly damaging	0.77
Y4335:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4336:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4338:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Z1088:Unc80	UTSW	1	66646451	missense	possibly damaging	0.85
Z1176:Unc80	UTSW	1	66694409	missense	probably benign
Z1177:Unc80	UTSW	1	66646398	missense	possibly damaging	0.72
Z1177:Unc80	UTSW	1	66695339	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAATTTTGAGAGCTTGGGGC -3'
(R):5'- CCATGTTTAAGGCTGCTGTAC -3'

Sequencing Primer
(F):5'- GTCTTCCTTTCCAAGCCTAAAAAG -3'
(R):5'- CATTGCTTATTTCAGGCTAGAAGACC -3'

Posted On

2014-08-25