Incidental Mutation 'R2037:Pld4'
ID224828
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112768558 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 483 (D483G)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888] [ENSMUST00000101010] [ENSMUST00000128258]
Predicted Effect probably damaging
Transcript: ENSMUST00000063888
AA Change: D483G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: D483G

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101010
SMART Domains Protein: ENSMUSP00000098572
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 717 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128258
SMART Domains Protein: ENSMUSP00000122404
Gene: ENSMUSG00000072812

DomainStartEndE-ValueType
low complexity region 5 66 N/A INTRINSIC
internal_repeat_1 67 251 2.35e-83 PROSPERO
low complexity region 285 308 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
internal_repeat_1 413 597 2.35e-83 PROSPERO
low complexity region 734 756 N/A INTRINSIC
low complexity region 811 820 N/A INTRINSIC
low complexity region 1170 1181 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1523 1539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222886
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAACTTGTAGCAAGGGCC -3'
(R):5'- CCCTCAGTGGTGATCCTTTG -3'

Sequencing Primer
(F):5'- TGTAGCAAGGGCCACAGC -3'
(R):5'- CTCAGTGGTGATCCTTTGCTTGC -3'
Posted On2014-08-25