Mutagenetix > Incidental Mutations

Incidental Mutation 'R2037:Rasgrf2'

224833

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

MMRRC Submission

040044-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R2037 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 91902629 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 883 (D883E)

Ref Sequence

ENSEMBL: ENSMUSP00000096930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326]

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: D883E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: D883E

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000151408
AA Change: D282E

SMART Domains

Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: D282E

Domain	Start	End	E-Value	Type
RasGEFN	33	175	9.35e-15	SMART
RasGEFN	186	323	6.04e-9	SMART
RasGEF	349	586	2.97e-112	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,089,984		probably null	Het
AI987944	T	C	7: 41,374,391	Y391C	probably benign	Het
Ankfn1	A	T	11: 89,456,120	S296T	probably benign	Het
Apob	A	G	12: 8,007,488	D1957G	probably benign	Het
Baz1a	G	T	12: 54,929,646	P415Q	probably damaging	Het
Brca2	T	A	5: 150,540,669	H1299Q	probably benign	Het
C7	G	T	15: 5,034,238	S227*	probably null	Het
Catsperb	A	T	12: 101,507,962	R306S	probably damaging	Het
Cbx3	T	A	6: 51,471,813		probably null	Het
Ccdc129	A	G	6: 55,897,875	N270S	probably benign	Het
Ccnt2	A	G	1: 127,803,399	Y671C	probably damaging	Het
Crocc	A	G	4: 141,046,942		probably null	Het
Ctr9	G	A	7: 111,046,807	V669I	probably benign	Het
Dck	T	G	5: 88,772,717	Y99D	probably damaging	Het
Ddx52	T	A	11: 83,944,606	D119E	probably benign	Het
Dnah10	A	T	5: 124,746,704	K596N	probably benign	Het
Dnah7a	A	T	1: 53,582,582	V1128E	probably benign	Het
Dph1	A	T	11: 75,185,853		probably null	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Enthd1	A	G	15: 80,560,349	S2P	possibly damaging	Het
Erc1	A	C	6: 119,722,255	V802G	possibly damaging	Het
F8	ATCTCTCTC	ATCTCTC	X: 75,322,998		probably null	Het
Fam169a	C	A	13: 97,107,092	A210E	probably benign	Het
Fcmr	A	G	1: 130,878,333	D342G	possibly damaging	Het
Fgfr4	T	G	13: 55,167,889	V743G	possibly damaging	Het
Fsip2	A	G	2: 82,978,512	D1725G	probably damaging	Het
Heatr5b	A	T	17: 78,829,505	C195*	probably null	Het
Herc2	G	A	7: 56,205,961	A3882T	probably damaging	Het
Il20	T	A	1: 130,908,378	N143Y	probably damaging	Het
Inpp5b	A	G	4: 124,798,299	S892G	probably damaging	Het
Ipo13	A	T	4: 117,904,661	Y447*	probably null	Het
Kbtbd12	A	T	6: 88,617,797	N350K	probably benign	Het
Kiz	T	C	2: 146,969,960	F663S	probably damaging	Het
Matn2	A	G	15: 34,433,117	D870G	probably benign	Het
Methig1	C	T	15: 100,353,586	A126V	probably benign	Het
Mme	A	G	3: 63,328,260	D209G	probably null	Het
Mroh4	A	G	15: 74,609,761	F811L	possibly damaging	Het
Myo9b	G	T	8: 71,290,866	K190N	probably damaging	Het
Ncf1	T	C	5: 134,229,552	I6V	probably damaging	Het
Nmt2	T	C	2: 3,309,581	F121L	probably damaging	Het
Nol10	A	G	12: 17,361,151	D183G	probably benign	Het
Nsun7	T	C	5: 66,261,086	V53A	probably benign	Het
Olfr1045	T	C	2: 86,197,832	S307G	probably benign	Het
Olfr1054	T	C	2: 86,332,430	N309D	probably benign	Het
Olfr819	T	C	10: 129,966,140	I187V	probably benign	Het
Pappa2	A	T	1: 158,956,644	Y265*	probably null	Het
Pigg	G	A	5: 108,338,652	A724T	probably damaging	Het
Pik3r4	C	T	9: 105,650,335	R296C	probably benign	Het
Pkhd1l1	A	G	15: 44,568,221		probably null	Het
Pld4	A	G	12: 112,768,558	D483G	probably damaging	Het
Ppip5k1	C	T	2: 121,343,193	R399H	probably damaging	Het
Qrfpr	A	T	3: 36,182,657	H198Q	probably damaging	Het
Retnlg	T	C	16: 48,874,252	C88R	probably damaging	Het
Sin3a	C	T	9: 57,096,825	T287I	probably benign	Het
Slc44a1	GCC	GCCCCC	4: 53,563,243		probably benign	Het
Sppl2c	G	C	11: 104,186,481	V36L	probably benign	Het
Srp72	T	A	5: 76,976,491	I68N	probably damaging	Het
Srrm3	T	A	5: 135,854,377	S195R	probably damaging	Het
Srrm4	T	A	5: 116,467,828		probably benign	Het
Ssb	A	G	2: 69,868,819	S199G	probably benign	Het
Sult2a6	T	A	7: 14,254,709	Y42F	probably damaging	Het
Syne2	A	G	12: 76,025,569	T120A	probably benign	Het
Tas1r1	A	G	4: 152,028,170	F809L	probably damaging	Het
Tead3	A	G	17: 28,336,570	S117P	probably damaging	Het
Tefm	C	T	11: 80,140,230	R60H	probably damaging	Het
Tmem104	G	A	11: 115,201,395	R110H	possibly damaging	Het
Tnxb	G	A	17: 34,699,205	G2364D	probably damaging	Het
Vmn1r211	T	A	13: 22,851,964	I178F	probably damaging	Het
Vmn1r6	A	T	6: 57,003,124	Y235F	probably damaging	Het
Xrcc5	C	A	1: 72,346,370	T540K	probably benign	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4590:Rasgrf2	UTSW	13	92038281	missense	probably damaging	1.00
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CAGGAACCTGTGTCCTTCTG -3'
(R):5'- AGGCCTAACTAGTGACCCAC -3'

Sequencing Primer
(F):5'- GAACCTGTGTCCTTCTGATTTGACAG -3'
(R):5'- GAGCAACATTATTTAACCTTGCCTCG -3'

Posted On

2014-08-25