Incidental Mutation 'R1990:Tpx2'
ID224836
Institutional Source Beutler Lab
Gene Symbol Tpx2
Ensembl Gene ENSMUSG00000027469
Gene NameTPX2, microtubule-associated
SynonymsDIL2, p100, REPP86
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1990 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152847964-152895321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152890624 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 606 (M606K)
Ref Sequence ENSEMBL: ENSMUSP00000136457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028969] [ENSMUST00000109816] [ENSMUST00000164120] [ENSMUST00000178997]
Predicted Effect probably benign
Transcript: ENSMUST00000028969
AA Change: M606K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028969
Gene: ENSMUSG00000027469
AA Change: M606K

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109816
AA Change: M606K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105441
Gene: ENSMUSG00000027469
AA Change: M606K

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 7.4e-39 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 360 541 1e-62 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 6.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164120
AA Change: M606K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128888
Gene: ENSMUSG00000027469
AA Change: M606K

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178997
AA Change: M606K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136457
Gene: ENSMUSG00000027469
AA Change: M606K

DomainStartEndE-ValueType
Pfam:Aurora-A_bind 1 68 5.2e-40 PFAM
coiled coil region 213 242 N/A INTRINSIC
Pfam:TPX2_importin 362 489 2.7e-35 PFAM
low complexity region 608 619 N/A INTRINSIC
Pfam:TPX2 661 717 7.5e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic arrest at the morula stage, embryonic lethality and tetraploidy of cultured E1.5 embryos. Mice heterozygous for the gene trap allele exhibit aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Apob A T 12: 8,001,039 I1088F probably damaging Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cand1 A G 10: 119,210,067 S978P probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Glp1r T A 17: 30,930,748 C329S possibly damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Mta2 C T 19: 8,942,332 probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nexn A T 3: 152,252,939 F106I probably damaging Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Tpx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Tpx2 APN 2 152893591 missense probably damaging 1.00
IGL01810:Tpx2 APN 2 152884235 missense probably damaging 1.00
IGL01951:Tpx2 APN 2 152884176 missense probably benign 0.01
IGL02184:Tpx2 APN 2 152882320 nonsense probably null
IGL02422:Tpx2 APN 2 152873144 missense probably benign 0.00
IGL02441:Tpx2 APN 2 152882287 missense possibly damaging 0.88
reddened UTSW 2 152869724 missense probably benign 0.00
Shamed UTSW 2 152873104 missense probably benign
R0063:Tpx2 UTSW 2 152880123 missense probably damaging 0.99
R0076:Tpx2 UTSW 2 152893683 missense probably damaging 1.00
R0271:Tpx2 UTSW 2 152867367 splice site probably benign
R0311:Tpx2 UTSW 2 152890492 missense probably damaging 0.98
R0617:Tpx2 UTSW 2 152873138 missense probably benign 0.01
R1871:Tpx2 UTSW 2 152893603 missense probably damaging 1.00
R1882:Tpx2 UTSW 2 152869691 missense probably benign
R1991:Tpx2 UTSW 2 152890624 missense probably benign
R1992:Tpx2 UTSW 2 152890624 missense probably benign
R4686:Tpx2 UTSW 2 152889183 missense possibly damaging 0.62
R4712:Tpx2 UTSW 2 152885038 missense probably damaging 1.00
R4792:Tpx2 UTSW 2 152885096 missense probably damaging 0.98
R4873:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4875:Tpx2 UTSW 2 152893615 missense probably benign 0.00
R4991:Tpx2 UTSW 2 152869724 missense probably benign 0.00
R5178:Tpx2 UTSW 2 152875549 missense probably benign 0.01
R5757:Tpx2 UTSW 2 152885231 splice site probably null
R6158:Tpx2 UTSW 2 152873104 missense probably benign
R6225:Tpx2 UTSW 2 152876628 missense probably benign
R6539:Tpx2 UTSW 2 152876598 nonsense probably null
R6633:Tpx2 UTSW 2 152867354 missense probably damaging 1.00
R7358:Tpx2 UTSW 2 152876630 missense probably benign
R7741:Tpx2 UTSW 2 152867343 missense possibly damaging 0.84
X0023:Tpx2 UTSW 2 152885028 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGAGAGCTCCTTATGTTGCTC -3'
(R):5'- GATGAGCACAATTCAGCCTGC -3'

Sequencing Primer
(F):5'- GAGAGCTCCTTATGTTGCTCTTCTG -3'
(R):5'- CCTGGCCTTGTAGAGAAAACTTG -3'
Posted On2014-08-25