Mutagenetix > Incidental Mutations

Incidental Mutation 'R2037:C7'

224842

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000079105

Gene Name

complement component 7

Synonyms

LOC383055

MMRRC Submission

040044-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2037 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4988762-5063740 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 5034238 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 227 (S227*)

Ref Sequence

ENSEMBL: ENSMUSP00000106317 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110689]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083780

Predicted Effect

probably null
Transcript: ENSMUST00000110689
AA Change: S227*

SMART Domains

Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: S227*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
TSP1	30	80	1.95e-7	SMART
LDLa	84	121	6.53e-9	SMART
MACPF	248	450	9.45e-51	SMART
TSP1	503	551	1.62e-4	SMART
CCP	571	626	1.84e-9	SMART
CCP	631	688	2.23e-8	SMART
FIMAC	699	766	1.63e-24	SMART
FIMAC	773	841	4.65e-20	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	A	T	11: 110,089,984		probably null	Het
AI987944	T	C	7: 41,374,391	Y391C	probably benign	Het
Ankfn1	A	T	11: 89,456,120	S296T	probably benign	Het
Apob	A	G	12: 8,007,488	D1957G	probably benign	Het
Baz1a	G	T	12: 54,929,646	P415Q	probably damaging	Het
Brca2	T	A	5: 150,540,669	H1299Q	probably benign	Het
Catsperb	A	T	12: 101,507,962	R306S	probably damaging	Het
Cbx3	T	A	6: 51,471,813		probably null	Het
Ccdc129	A	G	6: 55,897,875	N270S	probably benign	Het
Ccnt2	A	G	1: 127,803,399	Y671C	probably damaging	Het
Crocc	A	G	4: 141,046,942		probably null	Het
Ctr9	G	A	7: 111,046,807	V669I	probably benign	Het
Dck	T	G	5: 88,772,717	Y99D	probably damaging	Het
Ddx52	T	A	11: 83,944,606	D119E	probably benign	Het
Dnah10	A	T	5: 124,746,704	K596N	probably benign	Het
Dnah7a	A	T	1: 53,582,582	V1128E	probably benign	Het
Dph1	A	T	11: 75,185,853		probably null	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
Enthd1	A	G	15: 80,560,349	S2P	possibly damaging	Het
Erc1	A	C	6: 119,722,255	V802G	possibly damaging	Het
F8	ATCTCTCTC	ATCTCTC	X: 75,322,998		probably null	Het
Fam169a	C	A	13: 97,107,092	A210E	probably benign	Het
Fcmr	A	G	1: 130,878,333	D342G	possibly damaging	Het
Fgfr4	T	G	13: 55,167,889	V743G	possibly damaging	Het
Fsip2	A	G	2: 82,978,512	D1725G	probably damaging	Het
Heatr5b	A	T	17: 78,829,505	C195*	probably null	Het
Herc2	G	A	7: 56,205,961	A3882T	probably damaging	Het
Il20	T	A	1: 130,908,378	N143Y	probably damaging	Het
Inpp5b	A	G	4: 124,798,299	S892G	probably damaging	Het
Ipo13	A	T	4: 117,904,661	Y447*	probably null	Het
Kbtbd12	A	T	6: 88,617,797	N350K	probably benign	Het
Kiz	T	C	2: 146,969,960	F663S	probably damaging	Het
Matn2	A	G	15: 34,433,117	D870G	probably benign	Het
Methig1	C	T	15: 100,353,586	A126V	probably benign	Het
Mme	A	G	3: 63,328,260	D209G	probably null	Het
Mroh4	A	G	15: 74,609,761	F811L	possibly damaging	Het
Myo9b	G	T	8: 71,290,866	K190N	probably damaging	Het
Ncf1	T	C	5: 134,229,552	I6V	probably damaging	Het
Nmt2	T	C	2: 3,309,581	F121L	probably damaging	Het
Nol10	A	G	12: 17,361,151	D183G	probably benign	Het
Nsun7	T	C	5: 66,261,086	V53A	probably benign	Het
Olfr1045	T	C	2: 86,197,832	S307G	probably benign	Het
Olfr1054	T	C	2: 86,332,430	N309D	probably benign	Het
Olfr819	T	C	10: 129,966,140	I187V	probably benign	Het
Pappa2	A	T	1: 158,956,644	Y265*	probably null	Het
Pigg	G	A	5: 108,338,652	A724T	probably damaging	Het
Pik3r4	C	T	9: 105,650,335	R296C	probably benign	Het
Pkhd1l1	A	G	15: 44,568,221		probably null	Het
Pld4	A	G	12: 112,768,558	D483G	probably damaging	Het
Ppip5k1	C	T	2: 121,343,193	R399H	probably damaging	Het
Qrfpr	A	T	3: 36,182,657	H198Q	probably damaging	Het
Rasgrf2	A	T	13: 91,902,629	D883E	probably damaging	Het
Retnlg	T	C	16: 48,874,252	C88R	probably damaging	Het
Sin3a	C	T	9: 57,096,825	T287I	probably benign	Het
Slc44a1	GCC	GCCCCC	4: 53,563,243		probably benign	Het
Sppl2c	G	C	11: 104,186,481	V36L	probably benign	Het
Srp72	T	A	5: 76,976,491	I68N	probably damaging	Het
Srrm3	T	A	5: 135,854,377	S195R	probably damaging	Het
Srrm4	T	A	5: 116,467,828		probably benign	Het
Ssb	A	G	2: 69,868,819	S199G	probably benign	Het
Sult2a6	T	A	7: 14,254,709	Y42F	probably damaging	Het
Syne2	A	G	12: 76,025,569	T120A	probably benign	Het
Tas1r1	A	G	4: 152,028,170	F809L	probably damaging	Het
Tead3	A	G	17: 28,336,570	S117P	probably damaging	Het
Tefm	C	T	11: 80,140,230	R60H	probably damaging	Het
Tmem104	G	A	11: 115,201,395	R110H	possibly damaging	Het
Tnxb	G	A	17: 34,699,205	G2364D	probably damaging	Het
Vmn1r211	T	A	13: 22,851,964	I178F	probably damaging	Het
Vmn1r6	A	T	6: 57,003,124	Y235F	probably damaging	Het
Xrcc5	C	A	1: 72,346,370	T540K	probably benign	Het

Other mutations in C7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02458:C7	APN	15	5059389	splice site	probably benign
IGL02803:C7	APN	15	5049560	missense	probably damaging	1.00
R0016:C7	UTSW	15	5046924	missense	probably benign	0.01
R0016:C7	UTSW	15	5046924	missense	probably benign	0.01
R0271:C7	UTSW	15	5015380	missense	possibly damaging	0.81
R0360:C7	UTSW	15	4988962	missense	probably benign	0.00
R0433:C7	UTSW	15	4988916	missense	probably damaging	1.00
R0505:C7	UTSW	15	4994142	splice site	probably benign
R1056:C7	UTSW	15	5045778	missense	possibly damaging	0.89
R1443:C7	UTSW	15	5059419	missense	probably benign	0.01
R1468:C7	UTSW	15	5012149	missense	probably damaging	1.00
R1468:C7	UTSW	15	5012149	missense	probably damaging	1.00
R1700:C7	UTSW	15	5002792	nonsense	probably null
R1774:C7	UTSW	15	5012075	missense	probably damaging	0.99
R1801:C7	UTSW	15	5012021	missense	possibly damaging	0.61
R1809:C7	UTSW	15	5034339	missense	probably damaging	0.99
R1986:C7	UTSW	15	5012012	missense	possibly damaging	0.94
R2047:C7	UTSW	15	5045661	missense	probably damaging	1.00
R2073:C7	UTSW	15	4990428	missense	probably benign	0.09
R3972:C7	UTSW	15	5007651	missense	possibly damaging	0.77
R4080:C7	UTSW	15	4990464	missense	probably benign	0.09
R4200:C7	UTSW	15	4990309	critical splice donor site	probably null
R4576:C7	UTSW	15	5002756	missense	probably damaging	1.00
R4815:C7	UTSW	15	5059405	missense	probably benign	0.16
R4995:C7	UTSW	15	5049592	missense	probably damaging	1.00
R5300:C7	UTSW	15	5031950	missense	probably damaging	1.00
R5562:C7	UTSW	15	5031915	nonsense	probably null
R5708:C7	UTSW	15	5015401	missense	possibly damaging	0.90
R5740:C7	UTSW	15	5057040	missense	probably benign	0.00
R5873:C7	UTSW	15	5005235	missense	probably damaging	1.00
R6222:C7	UTSW	15	5011941	missense	possibly damaging	0.89
R6516:C7	UTSW	15	5057081	missense	probably damaging	0.98
R6810:C7	UTSW	15	5007654	missense	probably damaging	0.98
R7019:C7	UTSW	15	5045682	missense	probably benign	0.04
R7199:C7	UTSW	15	4994243	missense	probably benign	0.09
R7276:C7	UTSW	15	5011967	missense	probably damaging	1.00
R7422:C7	UTSW	15	5012056	missense	probably benign	0.13
R7652:C7	UTSW	15	5012105	missense	probably damaging	1.00
R7783:C7	UTSW	15	5007710	missense	probably benign	0.08
R8266:C7	UTSW	15	5007659	missense	probably damaging	0.99
R8295:C7	UTSW	15	4988845	missense	probably damaging	1.00
Z1177:C7	UTSW	15	5015375	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CAGACTGGAACTATATAAGACCTGTC -3'
(R):5'- AGACTATGTGAAGAAAGTGTGCATC -3'

Sequencing Primer
(F):5'- GACCTGTCTCAAATGATGATGATG -3'
(R):5'- TGTGAAGAAAGTGTGCATCTTAAAAG -3'

Posted On

2014-08-25