Incidental Mutation 'R1990:Nexn'
ID224857
Institutional Source Beutler Lab
Gene Symbol Nexn
Ensembl Gene ENSMUSG00000039103
Gene Namenexilin
Synonyms1110046H09Rik, nF actin binding protein
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock #R1990 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152236982-152266350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152252939 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 106 (F106I)
Ref Sequence ENSEMBL: ENSMUSP00000142559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000196504] [ENSMUST00000196815] [ENSMUST00000198460] [ENSMUST00000198648] [ENSMUST00000198750] [ENSMUST00000199423] [ENSMUST00000199470] [ENSMUST00000199685] [ENSMUST00000200589]
Predicted Effect probably damaging
Transcript: ENSMUST00000046045
AA Change: F42I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103
AA Change: F42I

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196504
AA Change: F42I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143180
Gene: ENSMUSG00000039103
AA Change: F42I

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196529
Predicted Effect unknown
Transcript: ENSMUST00000196815
AA Change: N15K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198404
Predicted Effect probably damaging
Transcript: ENSMUST00000198460
AA Change: F106I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143573
Gene: ENSMUSG00000039103
AA Change: F106I

DomainStartEndE-ValueType
internal_repeat_1 14 35 1.01e-5 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 1.01e-5 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 345 N/A INTRINSIC
coiled coil region 378 406 N/A INTRINSIC
coiled coil region 429 480 N/A INTRINSIC
IG 506 590 2.1e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198648
AA Change: F42I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143294
Gene: ENSMUSG00000039103
AA Change: F42I

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198750
AA Change: F42I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142574
Gene: ENSMUSG00000039103
AA Change: F42I

DomainStartEndE-ValueType
coiled coil region 40 86 N/A INTRINSIC
coiled coil region 162 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199423
AA Change: F106I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142936
Gene: ENSMUSG00000039103
AA Change: F106I

DomainStartEndE-ValueType
internal_repeat_1 14 35 4.74e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 4.74e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 240 422 N/A INTRINSIC
coiled coil region 455 483 N/A INTRINSIC
coiled coil region 506 557 N/A INTRINSIC
IG 583 667 2e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199470
AA Change: F106I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103
AA Change: F106I

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199685
AA Change: F42I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142569
Gene: ENSMUSG00000039103
AA Change: F42I

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200589
AA Change: F106I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142559
Gene: ENSMUSG00000039103
AA Change: F106I

DomainStartEndE-ValueType
internal_repeat_1 14 35 8.44e-7 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 8.44e-7 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199752
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality with endomyocardial fibroelastosis, cardiac hypertrophy and dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Apob A T 12: 8,001,039 I1088F probably damaging Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cand1 A G 10: 119,210,067 S978P probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Glp1r T A 17: 30,930,748 C329S possibly damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Mta2 C T 19: 8,942,332 probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Nexn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Nexn APN 3 152247233 missense probably benign 0.00
IGL01681:Nexn APN 3 152243870 missense possibly damaging 0.86
IGL02098:Nexn APN 3 152243903 nonsense probably null
IGL02146:Nexn APN 3 152247248 missense probably benign 0.01
IGL02151:Nexn APN 3 152248244 missense probably damaging 0.99
R0369:Nexn UTSW 3 152248257 missense probably benign 0.40
R0540:Nexn UTSW 3 152248242 nonsense probably null
R1501:Nexn UTSW 3 152237686 missense possibly damaging 0.91
R1828:Nexn UTSW 3 152242768 missense probably damaging 1.00
R1903:Nexn UTSW 3 152248181 missense probably damaging 0.99
R2857:Nexn UTSW 3 152248043 missense probably damaging 1.00
R2858:Nexn UTSW 3 152248043 missense probably damaging 1.00
R4482:Nexn UTSW 3 152242753 missense probably damaging 0.99
R4593:Nexn UTSW 3 152252916 missense probably damaging 1.00
R4750:Nexn UTSW 3 152237722 missense probably damaging 1.00
R5113:Nexn UTSW 3 152243888 missense probably damaging 1.00
R5252:Nexn UTSW 3 152237953 missense probably benign 0.01
R5289:Nexn UTSW 3 152248072 missense probably benign 0.13
R5502:Nexn UTSW 3 152238304 missense probably damaging 1.00
R5746:Nexn UTSW 3 152242876 unclassified probably benign
R6230:Nexn UTSW 3 152238275 missense probably damaging 1.00
R7251:Nexn UTSW 3 152247195 missense probably damaging 0.96
R7523:Nexn UTSW 3 152247178 missense probably benign 0.01
R7571:Nexn UTSW 3 152253647 missense possibly damaging 0.80
R7587:Nexn UTSW 3 152247178 missense probably benign 0.01
R8359:Nexn UTSW 3 152248361 missense probably damaging 0.98
R8898:Nexn UTSW 3 152242669 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGCAACATCCTGATTAGTTCTCG -3'
(R):5'- CCACCTAGATTAAAGAAATGCTTGC -3'

Sequencing Primer
(F):5'- ACATCCTGATTAGTTCTCGTTTGTTC -3'
(R):5'- AGAAATGCTTGCTTCTGATGATGAG -3'
Posted On2014-08-25