Incidental Mutation 'R2037:Heatr5b'
ID224866
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 78829505 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 195 (C195*)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably null
Transcript: ENSMUST00000097281
AA Change: C195*
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: C195*

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATCCACTCAGAAGTCCGTGC -3'
(R):5'- GCTAGTTAGGTTGGAGAATTGTACC -3'

Sequencing Primer
(F):5'- TCAGAAGTCCGTGCCACAC -3'
(R):5'- GGTTTGACAACATGGTCCTAAAGC -3'
Posted On2014-08-25