Incidental Mutation 'R2041:Olfr1154'
ID224880
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2041 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87902797 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 293 (N293S)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably damaging
Transcript: ENSMUST00000099844
AA Change: N293S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: N293S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215017
AA Change: N293S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215862
AA Change: N293S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217436
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Alox8 T A 11: 69,197,691 H40L possibly damaging Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Gpr153 A G 4: 152,283,353 S554G probably benign Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Ndst3 C A 3: 123,672,215 G36V probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Ube3b T C 5: 114,387,233 L39P probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R3719:Olfr1154 UTSW 2 87903103 missense probably benign 0.05
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AATGCCCAGTTTCCAGTTTCAC -3'
(R):5'- TTAAAACAGGTTCTGCAGAGGG -3'

Sequencing Primer
(F):5'- ACTGGACTTTCTTTCTGAATGTAACC -3'
(R):5'- AGAAAGAAAGGGTTCTCTACTTGTGC -3'
Posted On2014-08-25