Incidental Mutation 'R1990:Catsperg2'
ID 224908
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Name cation channel sperm associated auxiliary subunit gamma 2
Synonyms CATSPERG, 1700067C01Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1990 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 29396644-29426457 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 29420470 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 223 (Y223*)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000209126] [ENSMUST00000208607]
AlphaFold C6KI89
Predicted Effect probably null
Transcript: ENSMUST00000061193
AA Change: Y223*
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: Y223*

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207115
AA Change: Y103*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208345
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect probably null
Transcript: ENSMUST00000209126
AA Change: Y223*
Predicted Effect probably null
Transcript: ENSMUST00000208607
AA Change: Y223*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,771,419 (GRCm39) R203* probably null Het
Acp6 T C 3: 97,083,054 (GRCm39) L355P probably damaging Het
Aebp2 T C 6: 140,579,464 (GRCm39) S234P probably damaging Het
Anapc7 A G 5: 122,577,567 (GRCm39) D374G probably benign Het
Apob A T 12: 8,051,039 (GRCm39) I1088F probably damaging Het
Arid4b T C 13: 14,307,021 (GRCm39) V92A probably damaging Het
Armc3 T C 2: 19,297,953 (GRCm39) Y575H probably damaging Het
Asxl2 G T 12: 3,534,558 (GRCm39) G252* probably null Het
Atl1 A T 12: 70,010,102 (GRCm39) K556M probably damaging Het
AU018091 A G 7: 3,212,104 (GRCm39) V206A probably benign Het
Bcas1 A T 2: 170,212,397 (GRCm39) D383E possibly damaging Het
Bmx A G X: 163,015,192 (GRCm39) W257R probably benign Het
Bpifb6 T C 2: 153,747,270 (GRCm39) probably null Het
Cacna1b G A 2: 24,622,318 (GRCm39) P222L probably damaging Het
Cand1 A G 10: 119,045,972 (GRCm39) S978P probably damaging Het
Cap2 T A 13: 46,791,357 (GRCm39) Y175N possibly damaging Het
Caps2 G A 10: 112,036,591 (GRCm39) A384T probably benign Het
Cd81 G T 7: 142,620,938 (GRCm39) G206* probably null Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cdkn2aip G T 8: 48,165,211 (GRCm39) N167K probably benign Het
Ceacam14 T A 7: 17,549,290 (GRCm39) L227* probably null Het
Ceacam5 A T 7: 17,491,805 (GRCm39) D725V probably damaging Het
Cldn34a A T X: 151,346,841 (GRCm39) H171L probably benign Het
Col18a1 T C 10: 76,916,988 (GRCm39) I114V unknown Het
Cp A G 3: 20,033,177 (GRCm39) D667G probably damaging Het
Cr2 G A 1: 194,836,458 (GRCm39) P1278S possibly damaging Het
Crat A G 2: 30,295,060 (GRCm39) Y452H possibly damaging Het
Cyp4f13 T A 17: 33,144,542 (GRCm39) H318L probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dmbt1 A G 7: 130,660,018 (GRCm39) N527S probably damaging Het
Fcgbpl1 A T 7: 27,853,785 (GRCm39) D1583V probably damaging Het
Fgb G T 3: 82,951,560 (GRCm39) Y256* probably null Het
Frmd3 T A 4: 74,105,676 (GRCm39) S441T probably damaging Het
Glp1r T A 17: 31,149,722 (GRCm39) C329S possibly damaging Het
Gm14190 G T 11: 99,581,431 (GRCm39) Q46K unknown Het
Golt1b T A 6: 142,338,080 (GRCm39) F17Y probably damaging Het
Gsdmc A G 15: 63,673,748 (GRCm39) I179T probably benign Het
Gsdmc2 T A 15: 63,700,086 (GRCm39) M229L probably benign Het
Gulp1 A C 1: 44,805,274 (GRCm39) N121T possibly damaging Het
Ift122 T A 6: 115,901,328 (GRCm39) F1037I probably damaging Het
Ildr1 A T 16: 36,536,568 (GRCm39) Y199F probably damaging Het
Ints2 T A 11: 86,139,760 (GRCm39) H278L possibly damaging Het
Invs T C 4: 48,392,599 (GRCm39) V271A possibly damaging Het
Kcnj2 T C 11: 110,963,709 (GRCm39) I367T probably benign Het
Kif21b T C 1: 136,089,508 (GRCm39) S1115P probably damaging Het
Lce1k A T 3: 92,714,125 (GRCm39) C20S unknown Het
Lcmt2 C A 2: 120,970,762 (GRCm39) R107L probably benign Het
Letm1 A AG 5: 33,926,859 (GRCm39) probably null Het
Lrrc9 A C 12: 72,544,635 (GRCm39) R71S probably damaging Het
Mcc C A 18: 44,624,382 (GRCm39) E213* probably null Het
Mis18bp1 T C 12: 65,205,468 (GRCm39) T235A probably benign Het
Mta2 C T 19: 8,919,696 (GRCm39) probably benign Het
Nebl T A 2: 17,457,321 (GRCm39) I80F probably damaging Het
Nek10 A G 14: 14,860,764 (GRCm38) T467A probably benign Het
Nexn A T 3: 151,958,576 (GRCm39) F106I probably damaging Het
Nrdc T A 4: 108,896,972 (GRCm39) Y282* probably null Het
Nxf3 G A X: 134,976,583 (GRCm39) P380S possibly damaging Het
Oma1 C T 4: 103,178,971 (GRCm39) T208I probably damaging Het
Or1a1 T C 11: 74,086,989 (GRCm39) V220A probably damaging Het
Or4c31 A G 2: 88,291,686 (GRCm39) M1V probably null Het
Or4d10c C A 19: 12,065,620 (GRCm39) V179F probably damaging Het
Or4p21 A G 2: 88,277,033 (GRCm39) L83P probably damaging Het
Or51a42 A T 7: 103,708,335 (GRCm39) I158N possibly damaging Het
Or52l1 A T 7: 104,830,221 (GRCm39) C115S probably damaging Het
Or5p66 C A 7: 107,885,566 (GRCm39) G256* probably null Het
Or5p70 A G 7: 107,995,041 (GRCm39) Y238C probably benign Het
Panx2 A T 15: 88,953,941 (GRCm39) Y632F possibly damaging Het
Pdia4 T C 6: 47,773,589 (GRCm39) T587A probably benign Het
Piezo2 A T 18: 63,207,733 (GRCm39) L1426Q probably null Het
Pigk T A 3: 152,450,131 (GRCm39) Y212N probably damaging Het
Pramel22 T A 4: 143,380,838 (GRCm39) Y395F probably damaging Het
Prl3b1 C T 13: 27,429,775 (GRCm39) T71I possibly damaging Het
Rab3gap1 A G 1: 127,870,166 (GRCm39) E929G possibly damaging Het
Rabl3 T C 16: 37,384,079 (GRCm39) I162T probably benign Het
Rasgrf2 T A 13: 92,172,473 (GRCm39) T188S probably damaging Het
Slc12a2 A G 18: 58,043,358 (GRCm39) I601V possibly damaging Het
Slc25a42 A T 8: 70,644,519 (GRCm39) I60N probably benign Het
Slc2a3 C T 6: 122,713,694 (GRCm39) G173S probably damaging Het
Slc46a3 G A 5: 147,823,404 (GRCm39) T146M probably damaging Het
Specc1 C A 11: 61,920,120 (GRCm39) P7T possibly damaging Het
Sptbn4 T C 7: 27,123,235 (GRCm39) D229G probably benign Het
Sspo T C 6: 48,427,984 (GRCm39) I154T probably benign Het
Stx5a T C 19: 8,726,254 (GRCm39) probably null Het
Stxbp6 A T 12: 44,902,640 (GRCm39) C210* probably null Het
Tagap1 C T 17: 7,224,285 (GRCm39) R137Q probably benign Het
Tbc1d9 A G 8: 83,997,932 (GRCm39) Y1163C probably damaging Het
Tex14 T G 11: 87,440,296 (GRCm39) L1367R probably damaging Het
Tnnt3 C T 7: 142,065,262 (GRCm39) R131C possibly damaging Het
Tpx2 T A 2: 152,732,544 (GRCm39) M606K probably benign Het
Trim46 A T 3: 89,145,008 (GRCm39) Y489N probably damaging Het
Ttc28 C T 5: 111,424,188 (GRCm39) S1485L probably benign Het
Txnl1 T C 18: 63,812,585 (GRCm39) T70A probably benign Het
Unc80 T C 1: 66,731,708 (GRCm39) L3053P probably damaging Het
Wars1 G T 12: 108,854,359 (GRCm39) N18K possibly damaging Het
Wnt8a A G 18: 34,677,937 (GRCm39) D115G probably damaging Het
Xndc1 T A 7: 101,722,398 (GRCm39) V21E probably damaging Het
Zfp493 T A 13: 67,934,388 (GRCm39) C114S probably damaging Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29,404,829 (GRCm39) missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29,397,483 (GRCm39) missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29,400,568 (GRCm39) missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29,409,558 (GRCm39) missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29,404,090 (GRCm39) splice site probably null
IGL01961:Catsperg2 APN 7 29,421,097 (GRCm39) splice site probably benign
IGL02187:Catsperg2 APN 7 29,420,791 (GRCm39) missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29,418,990 (GRCm39) missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29,424,504 (GRCm39) missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29,397,650 (GRCm39) missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29,397,141 (GRCm39) missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29,424,904 (GRCm39) unclassified probably benign
IGL03247:Catsperg2 APN 7 29,416,473 (GRCm39) missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29,409,299 (GRCm39) missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29,409,586 (GRCm39) missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29,424,445 (GRCm39) splice site probably benign
R0281:Catsperg2 UTSW 7 29,405,996 (GRCm39) missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29,414,326 (GRCm39) missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29,420,723 (GRCm39) missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29,404,116 (GRCm39) missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29,400,121 (GRCm39) missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29,405,049 (GRCm39) missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29,397,671 (GRCm39) missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29,397,189 (GRCm39) missense probably benign 0.01
R3433:Catsperg2 UTSW 7 29,400,643 (GRCm39) missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29,404,527 (GRCm39) missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29,416,429 (GRCm39) missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29,405,060 (GRCm39) missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29,400,550 (GRCm39) missense probably damaging 0.98
R5033:Catsperg2 UTSW 7 29,409,559 (GRCm39) missense possibly damaging 0.93
R5093:Catsperg2 UTSW 7 29,416,423 (GRCm39) missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29,416,491 (GRCm39) missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29,397,263 (GRCm39) missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29,414,275 (GRCm39) missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29,405,015 (GRCm39) missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29,400,613 (GRCm39) missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29,397,257 (GRCm39) missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29,412,442 (GRCm39) missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29,418,938 (GRCm39) start gained probably benign
R6744:Catsperg2 UTSW 7 29,409,244 (GRCm39) missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29,404,750 (GRCm39) missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29,409,507 (GRCm39) missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29,406,026 (GRCm39) missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29,416,527 (GRCm39) missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29,409,251 (GRCm39) missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29,397,144 (GRCm39) missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29,412,406 (GRCm39) missense probably null 0.71
R7600:Catsperg2 UTSW 7 29,404,283 (GRCm39) missense probably benign 0.32
R8460:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8461:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8751:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8752:Catsperg2 UTSW 7 29,404,744 (GRCm39) missense possibly damaging 0.92
R8829:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R8832:Catsperg2 UTSW 7 29,397,269 (GRCm39) missense probably benign 0.33
R9264:Catsperg2 UTSW 7 29,397,613 (GRCm39) missense possibly damaging 0.72
R9284:Catsperg2 UTSW 7 29,405,006 (GRCm39) critical splice donor site probably null
R9468:Catsperg2 UTSW 7 29,409,432 (GRCm39) critical splice donor site probably null
Z1177:Catsperg2 UTSW 7 29,397,207 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGTGTAAGCACCTCTCCC -3'
(R):5'- TGGTAGTGGGCATACTCAGAGG -3'

Sequencing Primer
(F):5'- CTCTCCATATATACCCTGAAAGAGG -3'
(R):5'- GCATACTCAGAGGAAAGGCAACC -3'
Posted On 2014-08-25