Incidental Mutation 'R0144:Manea'
ID22491
Institutional Source Beutler Lab
Gene Symbol Manea
Ensembl Gene ENSMUSG00000040520
Gene Namemannosidase, endo-alpha
Synonyms4932703L02Rik
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0144 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location26324506-26346891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26340719 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 81 (M81T)
Ref Sequence ENSEMBL: ENSMUSP00000038671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041374] [ENSMUST00000153813]
Predicted Effect probably benign
Transcript: ENSMUST00000041374
AA Change: M81T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038671
Gene: ENSMUSG00000040520
AA Change: M81T

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_hydro_99 98 448 3.2e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140492
Predicted Effect probably benign
Transcript: ENSMUST00000153813
SMART Domains Protein: ENSMUSP00000115791
Gene: ENSMUSG00000040520

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-glycosylation of proteins is initiated in the endoplasmic reticulum (ER) by the transfer of the preassembled oligosaccharide glucose-3-mannose-9-N-acetylglucosamine-2 from dolichyl pyrophosphate to acceptor sites on the target protein by an oligosaccharyltransferase complex. This core oligosaccharide is sequentially processed by several ER glycosidases and by an endomannosidase (E.C. 3.2.1.130), such as MANEA, in the Golgi. MANEA catalyzes the release of mono-, di-, and triglucosylmannose oligosaccharides by cleaving the alpha-1,2-mannosidic bond that links them to high-mannose glycans (Hamilton et al., 2005 [PubMed 15677381]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Mug2 A G 6: 122,071,011 probably benign Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Manea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Manea APN 4 26340578 missense probably damaging 1.00
IGL02066:Manea APN 4 26340965 utr 5 prime probably benign
IGL02195:Manea APN 4 26340628 nonsense probably null
IGL02527:Manea APN 4 26336619 critical splice donor site probably null
IGL02727:Manea APN 4 26328126 missense probably damaging 1.00
IGL02727:Manea APN 4 26328127 nonsense probably null
R0099:Manea UTSW 4 26328104 missense probably damaging 1.00
R0103:Manea UTSW 4 26329080 splice site probably null
R0839:Manea UTSW 4 26327983 missense probably damaging 1.00
R1998:Manea UTSW 4 26327871 missense probably damaging 1.00
R1999:Manea UTSW 4 26327871 missense probably damaging 1.00
R5022:Manea UTSW 4 26336630 nonsense probably null
R6621:Manea UTSW 4 26340363 unclassified probably null
R7113:Manea UTSW 4 26336718 missense probably damaging 1.00
R7436:Manea UTSW 4 26328228 missense probably damaging 1.00
R7553:Manea UTSW 4 26327986 missense probably damaging 1.00
R7649:Manea UTSW 4 26328234 missense probably damaging 1.00
R7680:Manea UTSW 4 26340649 missense probably damaging 1.00
R7690:Manea UTSW 4 26327910 missense probably benign 0.41
R7698:Manea UTSW 4 26327763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTCAGTCCTAAAGACCCTTCC -3'
(R):5'- AACGCAGCATCCTTTGGACCTC -3'

Sequencing Primer
(F):5'- aaataattaCCAACCAATTGAGGCTG -3'
(R):5'- GGACCTCCTTTTGGACTTGAC -3'
Posted On2013-04-16