Incidental Mutation 'R1990:Cand1'
ID224948
Institutional Source Beutler Lab
Gene Symbol Cand1
Ensembl Gene ENSMUSG00000020114
Gene Namecullin associated and neddylation disassociated 1
SynonymsD10Ertd516e, 2310038O07Rik, 6330512O03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1990 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location119199255-119240055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119210067 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 978 (S978P)
Ref Sequence ENSEMBL: ENSMUSP00000020315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020315]
Predicted Effect probably damaging
Transcript: ENSMUST00000020315
AA Change: S978P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020315
Gene: ENSMUSG00000020114
AA Change: S978P

DomainStartEndE-ValueType
SCOP:d1qgra_ 53 994 4e-44 SMART
Pfam:TIP120 1040 1203 1.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149155
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of Cullin-RING ubiquitin ligases, which are in involved in ubiquitinylation of proteins degraded by the Ub proteasome system. The encoded protein binds to unneddylated cullin-RING box protein complexes and acts as an inhibitor of cullin neddylation and of Skp1, cullin, and F box ubiquitin ligase complex assembly and activity. In mammalian cell culture, this protein predominantly localizes to the cytoplasm. Knockdown of this gene in preadipocytes results in blocked adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Apob A T 12: 8,001,039 I1088F probably damaging Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Glp1r T A 17: 30,930,748 C329S possibly damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Mta2 C T 19: 8,942,332 probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nexn A T 3: 152,252,939 F106I probably damaging Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Cand1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cand1 APN 10 119211135 missense probably benign 0.00
IGL00917:Cand1 APN 10 119210936 missense possibly damaging 0.87
IGL01383:Cand1 APN 10 119208167 missense probably damaging 0.96
IGL02016:Cand1 APN 10 119212568 missense probably damaging 0.98
IGL02271:Cand1 APN 10 119211721 missense probably damaging 1.00
IGL02282:Cand1 APN 10 119210709 missense probably benign 0.26
IGL02494:Cand1 APN 10 119213617 missense probably benign
IGL02527:Cand1 APN 10 119206807 missense probably damaging 1.00
IGL02675:Cand1 APN 10 119219697 missense probably damaging 0.99
IGL02796:Cand1 UTSW 10 119213638 missense probably damaging 1.00
R0114:Cand1 UTSW 10 119216522 missense probably benign
R0667:Cand1 UTSW 10 119216520 missense probably benign 0.00
R1589:Cand1 UTSW 10 119213566 missense probably damaging 0.97
R1591:Cand1 UTSW 10 119211869 missense possibly damaging 0.63
R1626:Cand1 UTSW 10 119210014 missense possibly damaging 0.46
R1771:Cand1 UTSW 10 119208306 missense probably benign 0.05
R1937:Cand1 UTSW 10 119203020 missense probably damaging 1.00
R1951:Cand1 UTSW 10 119208020 splice site probably benign
R3522:Cand1 UTSW 10 119239197 missense probably benign 0.01
R4207:Cand1 UTSW 10 119211845 missense probably damaging 1.00
R4209:Cand1 UTSW 10 119211558 missense probably benign 0.24
R4502:Cand1 UTSW 10 119216667 missense probably benign
R4791:Cand1 UTSW 10 119210702 missense probably benign 0.02
R4841:Cand1 UTSW 10 119213546 critical splice donor site probably null
R4842:Cand1 UTSW 10 119213546 critical splice donor site probably null
R5326:Cand1 UTSW 10 119212028 missense probably benign
R5606:Cand1 UTSW 10 119211454 missense possibly damaging 0.63
R5613:Cand1 UTSW 10 119215323 missense possibly damaging 0.93
R5768:Cand1 UTSW 10 119211005 missense probably benign 0.06
R5884:Cand1 UTSW 10 119213765 missense possibly damaging 0.90
R6006:Cand1 UTSW 10 119210028 missense possibly damaging 0.83
R6062:Cand1 UTSW 10 119218010 missense possibly damaging 0.89
R6734:Cand1 UTSW 10 119211992 missense possibly damaging 0.67
R6838:Cand1 UTSW 10 119210030 missense probably benign 0.21
R7058:Cand1 UTSW 10 119211754 missense probably benign 0.00
R7342:Cand1 UTSW 10 119211787 missense possibly damaging 0.64
R7425:Cand1 UTSW 10 119216243 missense probably benign 0.00
R7705:Cand1 UTSW 10 119212438 critical splice donor site probably null
R7812:Cand1 UTSW 10 119217959 missense probably benign 0.04
R7916:Cand1 UTSW 10 119216588 missense probably benign 0.00
R7982:Cand1 UTSW 10 119216473 missense probably damaging 0.97
R8117:Cand1 UTSW 10 119206816 missense probably damaging 1.00
Z1176:Cand1 UTSW 10 119239194 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGATACTAGGGTAAGCAACGC -3'
(R):5'- GACTTGTCAGTGTTTAGCCAATTAG -3'

Sequencing Primer
(F):5'- GCTGAGAACCTTAACAAAGCTTTAC -3'
(R):5'- ACAGCAGGTTGGGACAAT -3'
Posted On2014-08-25