Incidental Mutation 'R2041:Alox8'
ID224961
Institutional Source Beutler Lab
Gene Symbol Alox8
Ensembl Gene ENSMUSG00000020891
Gene Namearachidonate 8-lipoxygenase
Synonyms8-LOX, 8S-lipoxygenase, 8S-LOX, Alox15b
MMRRC Submission 040048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2041 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69183932-69197843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69197691 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 40 (H40L)
Ref Sequence ENSEMBL: ENSMUSP00000021262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021262] [ENSMUST00000094078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021262
AA Change: H40L

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021262
Gene: ENSMUSG00000020891
AA Change: H40L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 163 662 5.5e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094078
AA Change: H40L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000091621
Gene: ENSMUSG00000020891
AA Change: H40L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 205 405 6.9e-44 PFAM
Pfam:Lipoxygenase 402 640 1.9e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156157
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene belongs to the lipoxygenase (LOX) gene family whose members encode enzymes that catalyze the addition of molecular oxygen to polyunsaturated fatty acids (PUFAs) to yield fatty acid hydroperoxides. The encoded enzyme preferentially metabolizes arachidonic acid to yield 8-hydroxyeicosatetraenoic acid (8-HETE), while metabolizing linoleic acid less efficiently. The gene may also function as a tumor suppressor. This gene is located in a cluster of related genes that spans approximately 75 kilobases on chromosome 11. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,401 D265E probably damaging Het
2610021A01Rik A G 7: 41,625,979 R369G possibly damaging Het
Actr3b T C 5: 25,760,130 probably null Het
Adamts12 A T 15: 11,215,735 M281L probably damaging Het
Aipl1 T A 11: 72,031,506 M126L possibly damaging Het
Akap12 C T 10: 4,356,489 P1100S probably benign Het
Anks1 T A 17: 28,008,414 F659L probably damaging Het
Asxl3 G T 18: 22,523,451 R1506L probably benign Het
Bicd2 A G 13: 49,341,776 T36A probably benign Het
Ccar1 A T 10: 62,766,048 L448Q probably damaging Het
Ccdc17 T G 4: 116,599,592 N497K probably damaging Het
Chek2 T C 5: 110,848,664 I164T probably damaging Het
Cntnap5c T C 17: 58,104,770 probably null Het
Cntnap5c T A 17: 58,198,989 D669E probably benign Het
Cpsf6 A G 10: 117,359,128 I482T probably damaging Het
Csf3 C T 11: 98,701,657 S65L possibly damaging Het
Dlc1 A G 8: 36,582,768 Y1049H probably damaging Het
Dnah6 T C 6: 73,073,439 D3048G probably damaging Het
Eif4g3 T A 4: 138,105,306 probably benign Het
Epb41l4b T C 4: 57,084,070 K195R probably damaging Het
Epn1 T C 7: 5,083,875 S41P probably damaging Het
Fam120a C A 13: 48,897,767 V721L probably benign Het
Fchsd1 T A 18: 37,967,676 probably null Het
Fer1l6 G A 15: 58,558,306 G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Fyb A C 15: 6,644,787 T635P possibly damaging Het
Gpr153 A G 4: 152,283,353 S554G probably benign Het
Grm1 A G 10: 10,746,603 F459L probably damaging Het
H60c C T 10: 3,259,972 G105D probably damaging Het
Ifnlr1 T A 4: 135,705,837 M528K possibly damaging Het
Lama4 A T 10: 39,069,991 D790V probably damaging Het
Mfsd13b T C 7: 120,991,916 probably benign Het
Mis12 T A 11: 71,025,306 I55N probably damaging Het
Morn1 T C 4: 155,090,942 Y103H probably damaging Het
Mrgpra2b C T 7: 47,464,160 V249I probably benign Het
Ndst3 C A 3: 123,672,215 G36V probably benign Het
Nlrp4a T A 7: 26,450,186 M406K probably damaging Het
Olfr1154 T C 2: 87,902,797 N293S probably damaging Het
Olfr1179 T C 2: 88,402,224 T237A probably damaging Het
Olfr1459 A T 19: 13,146,677 probably benign Het
Olfr574 T A 7: 102,948,963 V156E probably damaging Het
Olfr851 A T 9: 19,496,835 D29V probably benign Het
Pars2 A G 4: 106,653,617 T199A probably damaging Het
Plcb4 C T 2: 135,938,271 T172I probably damaging Het
Pomgnt2 A T 9: 121,982,288 W476R probably benign Het
Psg23 T A 7: 18,614,778 S35C possibly damaging Het
Pycrl T A 15: 75,919,295 probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rgs2 A G 1: 144,002,222 F80S probably damaging Het
Sall1 A G 8: 89,032,801 L225P probably benign Het
Setd3 A G 12: 108,113,392 I284T possibly damaging Het
Slc4a9 C T 18: 36,530,793 T290I possibly damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Ube3b T C 5: 114,387,233 L39P probably damaging Het
Ubr2 C A 17: 46,986,047 R269L probably damaging Het
Vrk2 A T 11: 26,547,914 I90K probably benign Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp984 A T 4: 147,755,339 C352S probably damaging Het
Other mutations in Alox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Alox8 APN 11 69188690 missense probably benign
IGL01878:Alox8 APN 11 69197038 missense probably benign 0.00
IGL02342:Alox8 APN 11 69186227 missense probably damaging 1.00
IGL02694:Alox8 APN 11 69186629 missense probably damaging 0.99
IGL03246:Alox8 APN 11 69186015 missense probably damaging 1.00
IGL03373:Alox8 APN 11 69186617 missense probably benign 0.00
R0567:Alox8 UTSW 11 69191522 critical splice donor site probably null
R1575:Alox8 UTSW 11 69185241 missense possibly damaging 0.94
R1688:Alox8 UTSW 11 69189906 missense probably benign 0.01
R2021:Alox8 UTSW 11 69186288 missense probably damaging 0.98
R2175:Alox8 UTSW 11 69187766 missense possibly damaging 0.85
R2237:Alox8 UTSW 11 69185771 missense probably benign 0.00
R3821:Alox8 UTSW 11 69186482 missense probably damaging 0.98
R4870:Alox8 UTSW 11 69186568 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69186505 missense probably damaging 1.00
R6836:Alox8 UTSW 11 69189889 missense possibly damaging 0.82
R7003:Alox8 UTSW 11 69191590 missense possibly damaging 0.70
R7158:Alox8 UTSW 11 69185870 missense probably benign 0.00
R7316:Alox8 UTSW 11 69186238 missense probably benign 0.01
R7513:Alox8 UTSW 11 69187844 missense probably benign 0.34
X0065:Alox8 UTSW 11 69185253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGGACTCGCAGCATC -3'
(R):5'- GGTAGCGAACACATTTCCCC -3'

Sequencing Primer
(F):5'- TCAGCACAGTGCCTACGTC -3'
(R):5'- ATCGCTGAGGTTAAATCACCCTG -3'
Posted On2014-08-25