Incidental Mutation 'R2041:Aipl1'
ID 224964
Institutional Source Beutler Lab
Gene Symbol Aipl1
Ensembl Gene ENSMUSG00000040554
Gene Name aryl hydrocarbon receptor-interacting protein-like 1
Synonyms A930007I01Rik
MMRRC Submission 040048-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R2041 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 71918789-71928335 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71922332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 126 (M126L)
Ref Sequence ENSEMBL: ENSMUSP00000061957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082]
AlphaFold Q924K1
Predicted Effect probably benign
Transcript: ENSMUST00000048207
AA Change: M126L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: M126L

DomainStartEndE-ValueType
Pfam:FKBP_C 26 154 5.2e-8 PFAM
Pfam:TPR_2 178 210 4.6e-6 PFAM
low complexity region 240 251 N/A INTRINSIC
Pfam:TPR_2 264 296 5.5e-6 PFAM
low complexity region 302 312 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000059082
AA Change: M126L

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554
AA Change: M126L

DomainStartEndE-ValueType
Pfam:FKBP_C 25 154 1e-8 PFAM
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,211 (GRCm39) D265E probably damaging Het
2610021A01Rik A G 7: 41,275,403 (GRCm39) R369G possibly damaging Het
Actr3b T C 5: 25,965,128 (GRCm39) probably null Het
Adamts12 A T 15: 11,215,821 (GRCm39) M281L probably damaging Het
Akap12 C T 10: 4,306,489 (GRCm39) P1100S probably benign Het
Alox8 T A 11: 69,088,517 (GRCm39) H40L possibly damaging Het
Anks1 T A 17: 28,227,388 (GRCm39) F659L probably damaging Het
Asxl3 G T 18: 22,656,508 (GRCm39) R1506L probably benign Het
Bicd2 A G 13: 49,495,252 (GRCm39) T36A probably benign Het
Ccar1 A T 10: 62,601,827 (GRCm39) L448Q probably damaging Het
Ccdc17 T G 4: 116,456,789 (GRCm39) N497K probably damaging Het
Chek2 T C 5: 110,996,530 (GRCm39) I164T probably damaging Het
Cntnap5c T C 17: 58,411,765 (GRCm39) probably null Het
Cntnap5c T A 17: 58,505,984 (GRCm39) D669E probably benign Het
Cpsf6 A G 10: 117,195,033 (GRCm39) I482T probably damaging Het
Csf3 C T 11: 98,592,483 (GRCm39) S65L possibly damaging Het
Dlc1 A G 8: 37,049,922 (GRCm39) Y1049H probably damaging Het
Dnah6 T C 6: 73,050,422 (GRCm39) D3048G probably damaging Het
Eif4g3 T A 4: 137,832,617 (GRCm39) probably benign Het
Epb41l4b T C 4: 57,084,070 (GRCm39) K195R probably damaging Het
Epn1 T C 7: 5,086,874 (GRCm39) S41P probably damaging Het
Fam120a C A 13: 49,051,243 (GRCm39) V721L probably benign Het
Fchsd1 T A 18: 38,100,729 (GRCm39) probably null Het
Fer1l6 G A 15: 58,430,155 (GRCm39) G194D probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,242,596 (GRCm39) probably null Het
Fyb1 A C 15: 6,674,268 (GRCm39) T635P possibly damaging Het
Gpr153 A G 4: 152,367,810 (GRCm39) S554G probably benign Het
Grm1 A G 10: 10,622,347 (GRCm39) F459L probably damaging Het
H60c C T 10: 3,209,972 (GRCm39) G105D probably damaging Het
Ifnlr1 T A 4: 135,433,148 (GRCm39) M528K possibly damaging Het
Lama4 A T 10: 38,945,987 (GRCm39) D790V probably damaging Het
Mfsd13b T C 7: 120,591,139 (GRCm39) probably benign Het
Mis12 T A 11: 70,916,132 (GRCm39) I55N probably damaging Het
Morn1 T C 4: 155,175,399 (GRCm39) Y103H probably damaging Het
Mrgpra2b C T 7: 47,113,908 (GRCm39) V249I probably benign Het
Ndst3 C A 3: 123,465,864 (GRCm39) G36V probably benign Het
Nlrp4a T A 7: 26,149,611 (GRCm39) M406K probably damaging Het
Or4p18 T C 2: 88,232,568 (GRCm39) T237A probably damaging Het
Or51t4 T A 7: 102,598,170 (GRCm39) V156E probably damaging Het
Or5b106 A T 19: 13,124,041 (GRCm39) probably benign Het
Or7g32 A T 9: 19,408,131 (GRCm39) D29V probably benign Het
Or9m1 T C 2: 87,733,141 (GRCm39) N293S probably damaging Het
Pars2 A G 4: 106,510,814 (GRCm39) T199A probably damaging Het
Plcb4 C T 2: 135,780,191 (GRCm39) T172I probably damaging Het
Pomgnt2 A T 9: 121,811,354 (GRCm39) W476R probably benign Het
Psg23 T A 7: 18,348,703 (GRCm39) S35C possibly damaging Het
Pycr3 T A 15: 75,791,144 (GRCm39) probably null Het
Rab3gap1 T C 1: 127,865,727 (GRCm39) V764A possibly damaging Het
Rgs2 A G 1: 143,877,960 (GRCm39) F80S probably damaging Het
Sall1 A G 8: 89,759,429 (GRCm39) L225P probably benign Het
Setd3 A G 12: 108,079,651 (GRCm39) I284T possibly damaging Het
Slc4a9 C T 18: 36,663,846 (GRCm39) T290I possibly damaging Het
Tmem87b T C 2: 128,673,509 (GRCm39) V251A probably damaging Het
Ube3b T C 5: 114,525,294 (GRCm39) L39P probably damaging Het
Ubr2 C A 17: 47,296,973 (GRCm39) R269L probably damaging Het
Vrk2 A T 11: 26,497,914 (GRCm39) I90K probably benign Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp984 A T 4: 147,839,796 (GRCm39) C352S probably damaging Het
Other mutations in Aipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Aipl1 APN 11 71,922,373 (GRCm39) missense probably damaging 1.00
IGL01713:Aipl1 APN 11 71,927,449 (GRCm39) missense probably damaging 1.00
IGL02031:Aipl1 APN 11 71,921,028 (GRCm39) utr 3 prime probably benign
IGL02603:Aipl1 APN 11 71,927,526 (GRCm39) missense possibly damaging 0.82
IGL02677:Aipl1 APN 11 71,920,222 (GRCm39) missense possibly damaging 0.90
R1563:Aipl1 UTSW 11 71,927,538 (GRCm39) missense probably damaging 0.99
R1835:Aipl1 UTSW 11 71,921,325 (GRCm39) missense possibly damaging 0.91
R2118:Aipl1 UTSW 11 71,920,195 (GRCm39) missense possibly damaging 0.92
R2216:Aipl1 UTSW 11 71,922,272 (GRCm39) missense probably damaging 1.00
R4001:Aipl1 UTSW 11 71,922,428 (GRCm39) missense probably damaging 1.00
R4969:Aipl1 UTSW 11 71,922,256 (GRCm39) missense probably benign 0.22
R5428:Aipl1 UTSW 11 71,921,313 (GRCm39) missense probably benign 0.02
R5933:Aipl1 UTSW 11 71,921,108 (GRCm39) missense probably benign 0.01
R8151:Aipl1 UTSW 11 71,927,584 (GRCm39) missense probably benign 0.44
R8379:Aipl1 UTSW 11 71,920,126 (GRCm39) missense probably benign 0.05
R8406:Aipl1 UTSW 11 71,922,332 (GRCm39) missense possibly damaging 0.87
R8998:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R8999:Aipl1 UTSW 11 71,921,083 (GRCm39) missense possibly damaging 0.93
R9340:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9346:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9422:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9424:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9462:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9576:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9577:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9578:Aipl1 UTSW 11 71,928,253 (GRCm39) missense probably damaging 1.00
R9593:Aipl1 UTSW 11 71,921,161 (GRCm39) missense probably benign
X0018:Aipl1 UTSW 11 71,921,367 (GRCm39) missense probably benign 0.00
Z1176:Aipl1 UTSW 11 71,921,359 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AATGAGCCTTTTCCTAGTGGTG -3'
(R):5'- ATCCTGGAACATCAGCGCTC -3'

Sequencing Primer
(F):5'- CAACTTTCAGTTTTGCTGGGGTCC -3'
(R):5'- AACATCAGCGCTCTGTGGTG -3'
Posted On 2014-08-25