Incidental Mutation 'R1990:Apob'
ID224965
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R1990 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8001039 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1088 (I1088F)
Ref Sequence ENSEMBL: ENSMUSP00000035761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811]
Predicted Effect probably damaging
Transcript: ENSMUST00000037520
AA Change: I1088F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: I1088F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037811
AA Change: I1101F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: I1101F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,065,658 R203* probably null Het
9530053A07Rik A T 7: 28,154,360 D1583V probably damaging Het
Acp6 T C 3: 97,175,738 L355P probably damaging Het
Aebp2 T C 6: 140,633,738 S234P probably damaging Het
Anapc7 A G 5: 122,439,504 D374G probably benign Het
Arid4b T C 13: 14,132,436 V92A probably damaging Het
Armc3 T C 2: 19,293,142 Y575H probably damaging Het
Asxl2 G T 12: 3,484,558 G252* probably null Het
Atl1 A T 12: 69,963,328 K556M probably damaging Het
AU018091 A G 7: 3,162,264 V206A probably benign Het
Bcas1 A T 2: 170,370,477 D383E possibly damaging Het
Bmx A G X: 164,232,196 W257R probably benign Het
Bpifb6 T C 2: 153,905,350 probably null Het
Cacna1b G A 2: 24,732,306 P222L probably damaging Het
Cand1 A G 10: 119,210,067 S978P probably damaging Het
Cap2 T A 13: 46,637,881 Y175N possibly damaging Het
Caps2 G A 10: 112,200,686 A384T probably benign Het
Catsperg2 A T 7: 29,721,045 Y223* probably null Het
Cd81 G T 7: 143,067,201 G206* probably null Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkn2aip G T 8: 47,712,176 N167K probably benign Het
Ceacam14 T A 7: 17,815,365 L227* probably null Het
Ceacam5 A T 7: 17,757,880 D725V probably damaging Het
Cldn34a A T X: 152,563,845 H171L probably benign Het
Col18a1 T C 10: 77,081,154 I114V unknown Het
Cp A G 3: 19,979,013 D667G probably damaging Het
Cr2 G A 1: 195,154,150 P1278S possibly damaging Het
Crat A G 2: 30,405,048 Y452H possibly damaging Het
Cyp4f13 T A 17: 32,925,568 H318L probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dmbt1 A G 7: 131,058,288 N527S probably damaging Het
Fgb G T 3: 83,044,253 Y256* probably null Het
Frmd3 T A 4: 74,187,439 S441T probably damaging Het
Glp1r T A 17: 30,930,748 C329S possibly damaging Het
Gm13088 T A 4: 143,654,268 Y395F probably damaging Het
Gm13757 A G 2: 88,446,689 L83P probably damaging Het
Gm14190 G T 11: 99,690,605 Q46K unknown Het
Golt1b T A 6: 142,392,354 F17Y probably damaging Het
Gsdmc A G 15: 63,801,899 I179T probably benign Het
Gsdmc2 T A 15: 63,828,237 M229L probably benign Het
Gulp1 A C 1: 44,766,114 N121T possibly damaging Het
Ift122 T A 6: 115,924,367 F1037I probably damaging Het
Ildr1 A T 16: 36,716,206 Y199F probably damaging Het
Ints2 T A 11: 86,248,934 H278L possibly damaging Het
Invs T C 4: 48,392,599 V271A possibly damaging Het
Kcnj2 T C 11: 111,072,883 I367T probably benign Het
Kif21b T C 1: 136,161,770 S1115P probably damaging Het
Lce1k A T 3: 92,806,818 C20S unknown Het
Lcmt2 C A 2: 121,140,281 R107L probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lrrc9 A C 12: 72,497,861 R71S probably damaging Het
Mcc C A 18: 44,491,315 E213* probably null Het
Mis18bp1 T C 12: 65,158,694 T235A probably benign Het
Mta2 C T 19: 8,942,332 probably benign Het
Nebl T A 2: 17,452,510 I80F probably damaging Het
Nek10 A G 14: 14,860,764 T467A probably benign Het
Nexn A T 3: 152,252,939 F106I probably damaging Het
Nrd1 T A 4: 109,039,775 Y282* probably null Het
Nxf3 G A X: 136,075,834 P380S possibly damaging Het
Olfr1183 A G 2: 88,461,342 M1V probably null Het
Olfr1426 C A 19: 12,088,256 V179F probably damaging Het
Olfr403 T C 11: 74,196,163 V220A probably damaging Het
Olfr490 C A 7: 108,286,359 G256* probably null Het
Olfr495 A G 7: 108,395,834 Y238C probably benign Het
Olfr643 A T 7: 104,059,128 I158N possibly damaging Het
Olfr685 A T 7: 105,181,014 C115S probably damaging Het
Oma1 C T 4: 103,321,774 T208I probably damaging Het
Panx2 A T 15: 89,069,738 Y632F possibly damaging Het
Pdia4 T C 6: 47,796,655 T587A probably benign Het
Piezo2 A T 18: 63,074,662 L1426Q probably null Het
Pigk T A 3: 152,744,494 Y212N probably damaging Het
Prl3b1 C T 13: 27,245,792 T71I possibly damaging Het
Rab3gap1 A G 1: 127,942,429 E929G possibly damaging Het
Rabl3 T C 16: 37,563,717 I162T probably benign Het
Rasgrf2 T A 13: 92,035,965 T188S probably damaging Het
Slc12a2 A G 18: 57,910,286 I601V possibly damaging Het
Slc25a42 A T 8: 70,191,869 I60N probably benign Het
Slc2a3 C T 6: 122,736,735 G173S probably damaging Het
Slc46a3 G A 5: 147,886,594 T146M probably damaging Het
Specc1 C A 11: 62,029,294 P7T possibly damaging Het
Sptbn4 T C 7: 27,423,810 D229G probably benign Het
Sspo T C 6: 48,451,050 I154T probably benign Het
Stx5a T C 19: 8,748,890 probably null Het
Stxbp6 A T 12: 44,855,857 C210* probably null Het
Tagap1 C T 17: 6,956,886 R137Q probably benign Het
Tbc1d9 A G 8: 83,271,303 Y1163C probably damaging Het
Tex14 T G 11: 87,549,470 L1367R probably damaging Het
Tnnt3 C T 7: 142,511,525 R131C possibly damaging Het
Tpx2 T A 2: 152,890,624 M606K probably benign Het
Trim46 A T 3: 89,237,701 Y489N probably damaging Het
Ttc28 C T 5: 111,276,322 S1485L probably benign Het
Txnl1 T C 18: 63,679,514 T70A probably benign Het
Unc80 T C 1: 66,692,549 L3053P probably damaging Het
Wars G T 12: 108,888,433 N18K possibly damaging Het
Wnt8a A G 18: 34,544,884 D115G probably damaging Het
Xndc1 T A 7: 102,073,191 V21E probably damaging Het
Zfp493 T A 13: 67,786,269 C114S probably damaging Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
Aesthete UTSW 12 8010080 nonsense probably null
Essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4707:Apob UTSW 12 8006205 missense probably damaging 0.96
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 unclassified probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
R7474:Apob UTSW 12 8009185 missense probably benign 0.29
R7484:Apob UTSW 12 8006884 nonsense probably null
R7538:Apob UTSW 12 8002219 missense probably damaging 0.98
R7636:Apob UTSW 12 8009516 missense possibly damaging 0.86
R7646:Apob UTSW 12 8009189 missense probably damaging 0.99
R7787:Apob UTSW 12 7990780 missense probably damaging 0.97
R7793:Apob UTSW 12 8008124 missense probably damaging 0.99
R7836:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7895:Apob UTSW 12 8011933 missense probably benign 0.00
R7919:Apob UTSW 12 8001885 missense possibly damaging 0.72
R7978:Apob UTSW 12 8011933 missense probably benign 0.00
R8005:Apob UTSW 12 8009744 missense not run
R8013:Apob UTSW 12 8010798 missense not run
R8014:Apob UTSW 12 8010798 missense not run
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Z1176:Apob UTSW 12 7998011 missense not run
Z1176:Apob UTSW 12 8004978 missense not run
Z1177:Apob UTSW 12 7988765 missense not run
Z1177:Apob UTSW 12 8015249 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTGCATAACCTCACAGTACCC -3'
(R):5'- TGTCCAGCTGAGTATGAGCC -3'

Sequencing Primer
(F):5'- CTCTTTCAGGAGTGCAGCAGTC -3'
(R):5'- CCAGCTGAGTATGAGCCAAGGG -3'
Posted On2014-08-25