Incidental Mutation 'R0144:Mug2'
List |< first << previous [record 47 of 76] next >> last >|
ID22498
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission 038429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0144 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 122071011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably benign
Transcript: ENSMUST00000081777
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 87.0%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T A 12: 84,605,965 probably null Het
Acp6 T A 3: 97,165,829 probably benign Het
AI661453 A T 17: 47,469,299 probably benign Het
Aox1 A G 1: 58,070,074 I674V probably benign Het
Armc2 A T 10: 41,947,887 probably benign Het
Atp8b1 G C 18: 64,571,374 probably benign Het
Baz2b A T 2: 59,907,495 N1823K probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Brca1 A T 11: 101,526,121 S396T probably damaging Het
Btnl6 G T 17: 34,514,020 R290S probably benign Het
Casp8ap2 A G 4: 32,643,797 R957G possibly damaging Het
Ccdc13 A G 9: 121,827,351 L132P probably damaging Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Ccdc58 A T 16: 36,085,114 N92I possibly damaging Het
Ceacam15 G T 7: 16,673,191 H134N probably benign Het
Cep170 T C 1: 176,792,595 I46V probably benign Het
Cfap57 T C 4: 118,584,705 D722G probably damaging Het
Col11a1 A T 3: 114,113,594 D628V unknown Het
Csmd1 A T 8: 16,391,824 V342E probably benign Het
Dennd1a A G 2: 38,126,640 V64A probably damaging Het
Dlec1 G T 9: 119,142,866 G1345V probably benign Het
Dnah1 G A 14: 31,267,874 probably benign Het
Dock5 C T 14: 67,786,286 G1142D probably benign Het
Etv2 C A 7: 30,634,883 A142S probably benign Het
Fam110c C A 12: 31,074,501 T154K unknown Het
Fbxo17 C G 7: 28,735,340 D183E probably damaging Het
Fbxo30 T A 10: 11,295,220 W681R probably damaging Het
Fig4 A G 10: 41,258,049 Y413H probably damaging Het
Gab1 A G 8: 80,785,201 probably benign Het
Gabarapl1 T C 6: 129,533,448 M1T probably null Het
Gm4763 A G 7: 24,723,590 V101A possibly damaging Het
H2-M10.6 G A 17: 36,812,241 C22Y probably damaging Het
Igfn1 T C 1: 135,962,013 D2432G probably damaging Het
Il13 T C 11: 53,633,176 D60G possibly damaging Het
Iqgap1 A G 7: 80,751,920 L479P probably damaging Het
Itpr2 T A 6: 146,327,155 Q1314L probably damaging Het
Jrk C T 15: 74,706,156 G427S probably benign Het
Kcnb1 T G 2: 167,104,547 N794H probably damaging Het
Klhl8 A T 5: 103,867,938 S361R probably benign Het
Krt87 T C 15: 101,438,661 Y37C probably benign Het
Lbp A T 2: 158,319,710 S231C probably damaging Het
Lpin2 A G 17: 71,225,076 E142G probably damaging Het
Lrch4 G A 5: 137,638,543 probably null Het
Manea A G 4: 26,340,719 M81T probably benign Het
Mcm3ap A G 10: 76,481,015 T618A probably benign Het
Me3 A G 7: 89,739,872 D128G probably damaging Het
Myo9b A T 8: 71,346,043 Q901L probably damaging Het
Nalcn T C 14: 123,371,536 R640G probably damaging Het
Nalcn C T 14: 123,409,839 probably benign Het
Ncor1 T C 11: 62,392,595 N422S probably damaging Het
Nf1 T A 11: 79,547,127 Y88N probably damaging Het
Nrxn3 G A 12: 89,348,392 A358T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr486 T C 7: 108,171,971 I258V probably benign Het
Olfr593 A T 7: 103,212,540 I216F probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pld5 T C 1: 175,970,541 N431D probably benign Het
Prss28 G A 17: 25,309,450 V16M probably damaging Het
Psmd2 T A 16: 20,662,225 probably null Het
Ptpn21 A T 12: 98,688,609 S700T probably benign Het
Rasa2 A T 9: 96,592,019 V152D probably damaging Het
Reln G T 5: 21,948,449 R2286S probably damaging Het
Rflnb G T 11: 76,024,963 P102Q probably damaging Het
Rin2 G A 2: 145,876,639 V680I probably damaging Het
Rnf213 A T 11: 119,479,600 K4742* probably null Het
Rpp40 A T 13: 35,901,369 S143T probably benign Het
Rps12 A G 10: 23,786,791 I51T probably benign Het
Rsf1 T A 7: 97,636,407 W109R probably damaging Het
Sipa1l2 C T 8: 125,449,876 probably null Het
Tspan5 G T 3: 138,898,348 V165L probably damaging Het
Uts2r T A 11: 121,161,465 V385E probably benign Het
Vma21-ps T A 4: 52,497,231 D5V possibly damaging Het
Vmn2r62 T A 7: 42,789,016 N132I probably damaging Het
Zfp622 T C 15: 25,991,579 probably benign Het
Zmiz1 A G 14: 25,655,247 K766R probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8348:Mug2 UTSW 6 122072233 nonsense probably null
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGACACCATCACTGAATGGAAG -3'
(R):5'- GGCTTGCAAAGATGTCGTTTGCAC -3'

Sequencing Primer
(F):5'- CACTGAATGGAAGGCCGGAG -3'
(R):5'- GCTGTTTACATACTGGCAAAACC -3'
Posted On2013-04-16