Mutagenetix > Incidental Mutation

Incidental Mutation 'R1990:Tagap1'

225002

Institutional Source

Beutler Lab

Gene Symbol

Tagap1

Ensembl Gene

ENSMUSG00000052031

Gene Name

T cell activation GTPase activating protein 1

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1990 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6955011-6961156 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 6956886 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 137 (R137Q)

Ref Sequence

ENSEMBL: ENSMUSP00000070466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063683]

AlphaFold

P0CAX8

Predicted Effect

probably benign
Transcript: ENSMUST00000063683
AA Change: R137Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000070466
Gene: ENSMUSG00000052031
AA Change: R137Q

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	250	269	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231833

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,065,658	R203*	probably null	Het
9530053A07Rik	A	T	7: 28,154,360	D1583V	probably damaging	Het
Acp6	T	C	3: 97,175,738	L355P	probably damaging	Het
Aebp2	T	C	6: 140,633,738	S234P	probably damaging	Het
Anapc7	A	G	5: 122,439,504	D374G	probably benign	Het
Apob	A	T	12: 8,001,039	I1088F	probably damaging	Het
Arid4b	T	C	13: 14,132,436	V92A	probably damaging	Het
Armc3	T	C	2: 19,293,142	Y575H	probably damaging	Het
Asxl2	G	T	12: 3,484,558	G252*	probably null	Het
Atl1	A	T	12: 69,963,328	K556M	probably damaging	Het
AU018091	A	G	7: 3,162,264	V206A	probably benign	Het
Bcas1	A	T	2: 170,370,477	D383E	possibly damaging	Het
Bmx	A	G	X: 164,232,196	W257R	probably benign	Het
Bpifb6	T	C	2: 153,905,350		probably null	Het
Cacna1b	G	A	2: 24,732,306	P222L	probably damaging	Het
Cand1	A	G	10: 119,210,067	S978P	probably damaging	Het
Cap2	T	A	13: 46,637,881	Y175N	possibly damaging	Het
Caps2	G	A	10: 112,200,686	A384T	probably benign	Het
Catsperg2	A	T	7: 29,721,045	Y223*	probably null	Het
Cd81	G	T	7: 143,067,201	G206*	probably null	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdkn2aip	G	T	8: 47,712,176	N167K	probably benign	Het
Ceacam14	T	A	7: 17,815,365	L227*	probably null	Het
Ceacam5	A	T	7: 17,757,880	D725V	probably damaging	Het
Cldn34a	A	T	X: 152,563,845	H171L	probably benign	Het
Col18a1	T	C	10: 77,081,154	I114V	unknown	Het
Cp	A	G	3: 19,979,013	D667G	probably damaging	Het
Cr2	G	A	1: 195,154,150	P1278S	possibly damaging	Het
Crat	A	G	2: 30,405,048	Y452H	possibly damaging	Het
Cyp4f13	T	A	17: 32,925,568	H318L	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dmbt1	A	G	7: 131,058,288	N527S	probably damaging	Het
Fgb	G	T	3: 83,044,253	Y256*	probably null	Het
Frmd3	T	A	4: 74,187,439	S441T	probably damaging	Het
Glp1r	T	A	17: 30,930,748	C329S	possibly damaging	Het
Gm13088	T	A	4: 143,654,268	Y395F	probably damaging	Het
Gm13757	A	G	2: 88,446,689	L83P	probably damaging	Het
Gm14190	G	T	11: 99,690,605	Q46K	unknown	Het
Golt1b	T	A	6: 142,392,354	F17Y	probably damaging	Het
Gsdmc	A	G	15: 63,801,899	I179T	probably benign	Het
Gsdmc2	T	A	15: 63,828,237	M229L	probably benign	Het
Gulp1	A	C	1: 44,766,114	N121T	possibly damaging	Het
Ift122	T	A	6: 115,924,367	F1037I	probably damaging	Het
Ildr1	A	T	16: 36,716,206	Y199F	probably damaging	Het
Ints2	T	A	11: 86,248,934	H278L	possibly damaging	Het
Invs	T	C	4: 48,392,599	V271A	possibly damaging	Het
Kcnj2	T	C	11: 111,072,883	I367T	probably benign	Het
Kif21b	T	C	1: 136,161,770	S1115P	probably damaging	Het
Lce1k	A	T	3: 92,806,818	C20S	unknown	Het
Lcmt2	C	A	2: 121,140,281	R107L	probably benign	Het
Letm1	A	AG	5: 33,769,515		probably null	Het
Lrrc9	A	C	12: 72,497,861	R71S	probably damaging	Het
Mcc	C	A	18: 44,491,315	E213*	probably null	Het
Mis18bp1	T	C	12: 65,158,694	T235A	probably benign	Het
Mta2	C	T	19: 8,942,332		probably benign	Het
Nebl	T	A	2: 17,452,510	I80F	probably damaging	Het
Nek10	A	G	14: 14,860,764	T467A	probably benign	Het
Nexn	A	T	3: 152,252,939	F106I	probably damaging	Het
Nrd1	T	A	4: 109,039,775	Y282*	probably null	Het
Nxf3	G	A	X: 136,075,834	P380S	possibly damaging	Het
Olfr1183	A	G	2: 88,461,342	M1V	probably null	Het
Olfr1426	C	A	19: 12,088,256	V179F	probably damaging	Het
Olfr403	T	C	11: 74,196,163	V220A	probably damaging	Het
Olfr490	C	A	7: 108,286,359	G256*	probably null	Het
Olfr495	A	G	7: 108,395,834	Y238C	probably benign	Het
Olfr643	A	T	7: 104,059,128	I158N	possibly damaging	Het
Olfr685	A	T	7: 105,181,014	C115S	probably damaging	Het
Oma1	C	T	4: 103,321,774	T208I	probably damaging	Het
Panx2	A	T	15: 89,069,738	Y632F	possibly damaging	Het
Pdia4	T	C	6: 47,796,655	T587A	probably benign	Het
Piezo2	A	T	18: 63,074,662	L1426Q	probably null	Het
Pigk	T	A	3: 152,744,494	Y212N	probably damaging	Het
Prl3b1	C	T	13: 27,245,792	T71I	possibly damaging	Het
Rab3gap1	A	G	1: 127,942,429	E929G	possibly damaging	Het
Rabl3	T	C	16: 37,563,717	I162T	probably benign	Het
Rasgrf2	T	A	13: 92,035,965	T188S	probably damaging	Het
Slc12a2	A	G	18: 57,910,286	I601V	possibly damaging	Het
Slc25a42	A	T	8: 70,191,869	I60N	probably benign	Het
Slc2a3	C	T	6: 122,736,735	G173S	probably damaging	Het
Slc46a3	G	A	5: 147,886,594	T146M	probably damaging	Het
Specc1	C	A	11: 62,029,294	P7T	possibly damaging	Het
Sptbn4	T	C	7: 27,423,810	D229G	probably benign	Het
Sspo	T	C	6: 48,451,050	I154T	probably benign	Het
Stx5a	T	C	19: 8,748,890		probably null	Het
Stxbp6	A	T	12: 44,855,857	C210*	probably null	Het
Tbc1d9	A	G	8: 83,271,303	Y1163C	probably damaging	Het
Tex14	T	G	11: 87,549,470	L1367R	probably damaging	Het
Tnnt3	C	T	7: 142,511,525	R131C	possibly damaging	Het
Tpx2	T	A	2: 152,890,624	M606K	probably benign	Het
Trim46	A	T	3: 89,237,701	Y489N	probably damaging	Het
Ttc28	C	T	5: 111,276,322	S1485L	probably benign	Het
Txnl1	T	C	18: 63,679,514	T70A	probably benign	Het
Unc80	T	C	1: 66,692,549	L3053P	probably damaging	Het
Wars	G	T	12: 108,888,433	N18K	possibly damaging	Het
Wnt8a	A	G	18: 34,544,884	D115G	probably damaging	Het
Xndc1	T	A	7: 102,073,191	V21E	probably damaging	Het
Zfp493	T	A	13: 67,786,269	C114S	probably damaging	Het

Other mutations in Tagap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Tagap1	APN	17	6956883	missense	probably benign	0.00
IGL02138:Tagap1	APN	17	6956086	missense	probably damaging	1.00
IGL02475:Tagap1	APN	17	6956427	missense	probably benign	0.41
IGL02955:Tagap1	APN	17	6956382	missense	probably damaging	1.00
R1494:Tagap1	UTSW	17	6956811	missense	probably damaging	1.00
R1824:Tagap1	UTSW	17	6956026	missense	probably benign	0.02
R2067:Tagap1	UTSW	17	6956860	missense	probably benign	0.00
R2086:Tagap1	UTSW	17	6956703	missense	probably benign	0.00
R2111:Tagap1	UTSW	17	6956860	missense	probably benign	0.00
R4425:Tagap1	UTSW	17	6956112	missense	probably benign	0.00
R5271:Tagap1	UTSW	17	6956096	nonsense	probably null
R5728:Tagap1	UTSW	17	6957021	missense	probably benign	0.30
R7100:Tagap1	UTSW	17	6956712	missense	possibly damaging	0.83
R8145:Tagap1	UTSW	17	6956127	missense	probably damaging	1.00
R9627:Tagap1	UTSW	17	6956928	missense	probably benign	0.09
R9698:Tagap1	UTSW	17	6961078	missense	probably damaging	0.99
Z1177:Tagap1	UTSW	17	6956617	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CAGAGTGAAGCTGTCCTCAC -3'
(R):5'- ACTTCCACCAAAGCATCGTTG -3'

Sequencing Primer
(F):5'- GAGTGAAGCTGTCCTCACTCCTTG -3'
(R):5'- AGAGCCTGGACAGAATGCTC -3'

Posted On

2014-08-25